What are the base pairing rules for DNA? Adenine (A) joins to i_and Cytosine (C) joins to ii (Choose the one correct answer below.) o i-guanine (G), ii - thymine (T) oi- thymine (T), ii- guanine (G) O i- cytosine (C), ii - adenine (A) O i-adenine (A), ii- cytosine (C)

What are the base pairing rules for DNA? Adenine (A) joins to i_and Cytosine (C) joins to ii (Choose the one correct answer below.) o i-guanine (G), ii - thymine (T) oi- thymine (T), ii- guanine (G) O i- cytosine (C), ii - adenine (A) O i-adenine (A), ii- cytosine (C)

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2SA: What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T

See similar textbooks

Related questions

Q: The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .…

A: DNA, short for deoxyribonucleic acid, is a nucleic acid molecule made up of a sugar called…

Q: In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand…

A: Introduction : The genetic material in most organisms is DNA or Deoxyribonucleic acid. The…

Q: Which of the following is true regarding the 5’ vs. the 3’ end of a strand of DNA? a) only…

A: 5' 3' linkage provides the sugar-phosphate backbone that gives DNA its structural rigidity. It is a…

Q: DNA molecules of different sizes are often separated with the use of a technique called…

A: Electrophoresis is a technique that is used to separate molecules based on their sizes.

Q: The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the…

A: chargaff's rule states that in DNA sequence in complementary strands the Adenine will form a bond…

Q: DRAW A DNA STRAND WITH 10 ADENINE BASES FOLLOWED BY 10 CYTOSINE BASES. IF THAT SAME STRAND BONDED TO…

A: Deoxyribonucleic acid (DNA) is a double helical structure, which is composed of nucleotides. The two…

Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…

A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…

Q: Based on Chargaff’s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the…

A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…

Q: What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…

Q: You have created a synthetic nucleotide, nucleotide X, which can be substituted into a DNA strand…

A: Introduction A nucleoside and a phosphate make up nucleotides, which are organic compounds. They…

Q: Watson and Crick, the pair of researchers who determined the structure of DNA, deduced the pairing…

A: According to Chargaff's rule : Pairing between nitrogen bases are followed by this - Adenind -…

Q: In the DNA sequence 5'-ACTG-3', the phosphodiester linkage between the cytosine and the thymine…

A: DNA Deoxy-Ribo-Nucleic is a molecule which stores the genetic information and instructions for…

Q: Make up your own DNA palindrome, of at least 6 bases long.

A: PALINDROME: The word 'palindrome' symbolizes number, phrase and sequence of characters…

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands…

A: Replication is bidirectional and originates at a single origin of replication ( Ori C ). Takes place…

Q: (a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue…

A: The given figure shows the mechanism of a DNA nuclease. Nucleases breaks the phosphodiester bonds of…

Q: The nucleotides are very specific as to which bond together. The four nucleotides are:Adenine (A)…

A: DNA nucleotides are adenine (A), thymine (T), guanine (G) and cytosine (C). These nucleotides come…

Q: How will each of the following substances or conditions affect DNA structure? a. ethanol; b. heat;…

A: Deoxyribonucleic acid or DNA is a molecule composed of two polynucleotide chains that coil around…

Q: What type of weak interactions stabilize DNA a) salt bridges between bases on opposite strands b)…

A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…

Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…

Q: Which of the following statements is (are) true? (a) The two strands of DNA run parallel from their…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…

A: Ans - a.) 5’- G A G C G A T C G C T C - 3’ 3'- C T C G C T A G C G A G -5'…

Q: Sarah is a scientist looking at specific sequences of base pairs on a DNA molecule within a specific…

A: Erwin chargaff gave Chargaff’s rule. According to chargaff’s rule, in dsDNA, 1. The molar ratio of A…

Q: If you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are…

A: According to Chargaff's rule, [A]+[G]=[C]+[T] where A - adenine G - Guanine C- Cytosine T- Thymine

Q: What role does bonding play in DNA? Where are hydrogen bonds located? Where are covalent bonds…

A: DNA is self replicating biomolecules that are present in chromosomes and carry genetic information…

Q: DNA structure depends on base pairing of its four nucleotides, A, C, T, and G. Nucleotide A pairs…

A: The monomeric units of nucleic acids are called nucleotides. DNA is a polynucleotide which contains…

Q: Which of the following statements are TRUE? I. DNA replication is a semiconservative process…

A: The true statement with explanation is discussed in step 2.

Q: H Н Н H

A: A tetranucleotide is a DNA fragment sequence having four bases. The answers to the question are…

Q: For double-stranded DNA, which of the following statements is true? a) A = C b) A = G and C = T c) A…

A: For double stranded DNA, According to Chargaff's rules state that DNA from any species of any…

Q: The statement “DNA replicates by a semiconservative mechanism” means that (a) only one DNA strand is…

A: Introduction DNA replication is a semi-conservative and semi-autonomous process. Semi-autonomous…

Q: A circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA…

A: Linking number is the topological property of . Linking number is a total of twists and writhes. The…

Q: Which of the following statements are TRUE? I. DNA replication is a semiconservative process…

A: INTRODUCTION DNA Deoxyribonucleic Acid, is the genetic material shows a semiconservative mode of…

Q: Which of the following single stranded DNA oligonucleotides alone would be expected to spontaneously…

A: DNA is a double stranded structure in which each strands are made up of nucleotides. Nucleotide is…

Q: Using the figure below, which end of the double helix,"A" or "B", would be considered the 5 prime…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Concept explainers

DNA and RNA

Deoxyribonucleic acid (DNA) is usually called the blueprint of life. Deoxyribose is a monosaccharide that has a key function in the synthesis of deoxyribonucleic acid. One less oxygen-containing hydroxyl group occurs in deoxyribose sugar. Nucleic acid, deoxyribonucleic acid, is one of the natural components. Deoxyribonucleic acid is a double-stranded molecule. Watson and Crick postulated the double-stranded model of the helix. A deoxyribonucleic acid is a molecular group that carries and transmits genetic information from parents to offspring. All eukaryotic and prokaryotic cells are involved.

DNA as the Genetic Material

DNA, or deoxyribonucleic acid, is a long polymeric nucleic acid molecule discovered in the late 1930s. It is a polymer; a long chain-like molecule made up of several monomers connected in a sequence. It possesses certain characteristics that qualify it as a genetic component. Certain organisms have different types of nucleic acids as their genetic material - DNA or RNA.

Genetics

The significant branch in science which involves the study of genes, gene variations, and the organism's heredity is known as genetics. It is also used to study the involvement of a gene or set of genes in the health of an individual and how it prevents several diseases in a human being. Thus, genetics also creates an understanding of various medical conditions.

DNA Replication

The mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of its own is defined as DNA replication. The DNA molecules utilize a semiconservative method for replication.

Question

What are the base pairing rules for DNA? Adenine (A) joins to
i_and Cytosine (C) joins to
ii
(Choose the one correct answer below.)
o i-guanine (G), ii - thymine (T)
oi- thymine (T), ii- guanine (G)
O i- cytosine (C), ii - adenine (A)
O i- adenine (A), ii- cytosine (C)

Expert Solution

Step 1

DNA is a polymer which is made up of various nucleotides. Each nucleotides is made up of a nitrogenous base, pentose sugar and a phosphate.

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T
Which of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.
Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
what is main difference for B-DNA，A-DNA and Z-DNA？（in biochemistry）
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
In a segment of DNA consisting of 1000 nitrogen bases, 28% of which are thymine, how many bases are adenine, guanine, and cytosine?
Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACAT
DNA structure depends on base pairing of its four nucleotides, A, C, T, and G. Nucleotide A pairs with T, and nucleotide C pairs with G. This forms a four-letter DNA “alphabet." Because DNA codes for amino acids in sets of three nucleotides, there are 4 cubed (4'), or 64, possible combinations, coding for 20 different amino acids. What is the best explanation for why there is no selective advantage for DNA to have five nucleotides (e.g., A, C, T, G, and E) with C pairing with either G or functionally equivalent E? It would be impossible to form the DNA molecule, because it must have an equal number of Cs and Gs. Because G and E have the same role, there would still be four functional letters of the alphabet. Replication would be inaccurate because sometimes C would bond with G and sometimes C would bond with E. There would be a five-letter alphabet with 125 combinations, which is too numerous. It is impossible because there are not five known nucleotides in the cell.
10. The two strands of DNA that make up the double helix are held to each other by … a) hydrogen bonds between guanine / cytosine, and thymine / adenine. b) hydrophobic bonds between adenine and thymine. c) hydrophobic bonds between guanine / cytosine, and thymine / adenine. d) hydrogen bonds between adenine and cytosine. e) 3′,5′ phosphodiester bonds involving deoxyribose.
The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T, 26 mol-%C, and 21 mol-%G (a) What is the base composition of the complementary DNA chain? (b) Is the total amount of purine bases equal to the total amount of pyrimidine bases for the DNA double helix?