Two complementary strands of DNA appear. One is labeled template strand and the other is labeled non- template strand. The template strand sequence is: ACTCG5¹ 3' CTTACTGTGTCGCAAATGTGCCG The complimentary sequence for the non-template strand is: 5' GAATGACACAGCGTTTACACGGCTGAGC3¹ The strands move apart and a new strand, labeled mRNA moves into the positon next to the template strand. For each instance of the letter C in the DNA template strand (letter G in the non-template strand), which letter should go in the mRNA strand? O O O O O с T A G
Coding Strand of DNA
When pointing to DNA transcription, the coding strand is found to be the DNA strand whose base sequence is indistinguishable from the base sequence of the RNA transcript developed. It is this strand that comprises the codons, while the non-coding strand comprises the anti-codons.
Nucleotide
Both DNA and RNA are composed of organic molecules known as nucleotides. Hence, nucleotides are known as the basic building blocks of nucleic acids. These substances play a role in various processes such as cell signalling, enzyme reactions, metabolism, and so on.
Structure of Cytosine
Cytosine is among the five primary nitrogenous bases of which DNA and RNA and are being used in storage and transportation of genetic makeup within a cell. Adenine, guanine, thymine as well as uracil are the remaining four nucleobases.


Trending now
This is a popular solution!
Step by step
Solved in 2 steps









