(True/False): A segment descriptor contains the base location of a segment.
Q: Pending Errands Active Errands Create new Errand Errand Description: Address: Username (Customer):…
A: The question did not mention or ask the specific technology and language. So I am providing the…
Q: How do you prevent the array from being modified accidentally in a function?
A: Passing Array is passed into a function as a pointer to the first element of the array. You can use…
Q: Generate intermediate code for the code segment: (a>b) or (b
A: Intermediate code for the given code segment
Q: de is must ---Below.
A: I have provided C++ CODE along with CODE SCREENSHOT and OUTPUT SCREENSHOT----------
Q: Programming Language : R programming (R Studio) A twin prime is a prime that has a prime gap of…
A: Introduction Prime Number: A prime number is a positive integer higher than one with no decimal…
Q: short answers : c)Give an example of a common floating point arithmetic error due to the particular…
A: an example of a common floating-point arithmetic error due to the particular way in which…
Q: C PROGRAMMING - write a function get_output which takes a two dimensional array as parameter and…
A: #include <stdio.h> int get_output(int n, int arr[n][n]){ int count=0; for (int i = 0; i…
Q: Programming Language (Code With C Programming Language) Problem Title : Visible Trees There is a…
A: #include <stdio.h>int main(){ //number of trees int N; scanf("%d",&N); //array to…
Q: Write a recursive function named factorial that accepts an integer n as a parameter and returns the…
A: As the programming language is not mentioned here we are using C++
Q: . void addOne (int ∗ptrNum ) Complete the function so it adds one to the integer referenced by…
A: Pointer in C is denoted with * symbol; int *ptrNum means pointer ptrNum of type int. Pointer stores…
Q: 1.) Formula for cell A15 that adds all data from B1 to D6. 2.) Formula for cell A16 that…
A: Here in excel we assume some data and according to our guidelines we solve first 3:…
Q: C Programming Language (Code With C Programming Language) Problem Title : Visible Trees There is a…
A: Take the example of Lestari. Lestari will be able to see the following tree in first row 1. 22 1 10…
Q: Input a number of your choice: 1 Enter a size of an array from 1-10: 4 Input 4 numbers: 21 9 14 30…
A: PROGRAM INTRODUCTION: Include the required header files. Start the definition of the main function.…
Q: 3- It is not possible to change the value of the pointer. (True or False). 4- If the following lines…
A: We need to answer questions related to C++ program. *As per the guidelines only 1st 3 question is…
Q: Which aggregating operations on struct variables are permissible but not on array variables?
A: Introduction: The following table summarizes the aggregate operations that are permitted on…
Q: Lab Assignment Question 2-Program in C++ to take input size of array from user and then take input…
A: To find sum of all elements in the array, initialise a variable sum=0 and run a loop from i=0 to…
Q: Consider an arranged circle line with demands including tracks 97,145,22,14,124,65 and 67. assuming…
A: We need to calculate the shortest distance between consecutive tracks while considering the circular…
Q: import numpy as np my_data=np.genfromtxt('data.csv,delimiter=',') #delete the top row (column names)…
A: The error in the above code is in line my_data=np.genfromtxt('data.csv, delimiter=',') Python is a…
Q: Give a program in C to count total number of alphabets, digits, and special characters in a string.
A: #include <string.h> int main(){ char s[1000]; int…
Q: C: Array & Loop
A: C code: #include<stdio.h>#define MAX 10void main(){int a,b,ch,n,i,j,k,l=0,p,f=0,sum=0;char…
Q: Which aggregating operations are permitted for struct variables but not array variables, and which…
A: What is programming: Programming is the process of designing, writing, testing, and maintaining…
Q: Lab Assignment Question 3-Program in C++ to take input size of array from user and then take input…
A: Take input size and values of array from user. After that initialise a variable sum=0. Run a loop…
Q: (Pick 5 Lotto) Write a program to simulate a pick-5 lottery game. Your program should generate and…
A: Given: Generate and store 5 distinct numbers between 1 and 9 (inclusive) into an array. The program…
Q: C++ Coding: Arrays True and False Code function definitions for eoNum() and output(): Both eoNum()…
A: #include <iostream> using namespace std; //eoNum function void eoNum(int a[],int b[],int n){…
Q: C++ Code: This function will print out the information that has been previously read (using the…
A: In the context of bioinformatics, it's often necessary to analyze a given DNA sequence to identify…
Q: Describe how to pass an array as a parameter to a function.
A: Passing an array as a parameter to function There are two ways to pass an array as a parameter to a…
Q: OVERVIEW OF DATA STRUCTURES. Task: Write a program to process a data array. Execute a custom task…
A: In this question we have to understand and code for the program in C++ array based operationLet's…
Q: Write a function that accepts an int array and the array's size as arguments. The function should…
A: The C++ code is given below with output screenshot Comments are also added.
Q: rin t] (Replace strings) Write the following function that replaces the occurrence of a substring…
A: #include <iostream>#include <string.h>using namespace std; bool same(string& s,…
Q: opic: Recursive Function A bank increases the interest rate it gives to its customers by 1% every…
A: total_amount 1st month: capital+capital*interest=capital(1+interest)=1stcapital 2st month:…
(True/False): A segment descriptor contains the base location of a segment.
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- (True/False): A segment description includes a segment's base location.C programming language questionProgramming Language : R programming (R Studio) A twin prime is a prime that has a prime gap of two. Sometimes the term twin prime isused for a pair of twin primes. For example, the five twin prime pairs are (3, 5), (5, 7),(11, 13), (17, 19) and (29, 31). Write a function that returns the number of all twin primepairs between 1 and a given number n.
- C Programming Language (Code With C Programming Language) Problem Title : Visible Trees There is a legend about a magical park with N × N trees. The trees are positioned in a square grid with N rows (numbered from 1 to N from north to south) and N columns (numbered from 1 to N from west to east). The height (in metres) of each tree is an integer between 1 and N × N, inclusive. Magically, the height of all trees is unique. Bunga is standing on the northmost point of the park and wants to count the number of visible trees for each Column. Similarly, Lestari is standing on the westmost point of the park and wants to count the number of visible trees for each Row. A tree X is visible if all other trees in front of the tree X are shorter than the tree X. For example, let N = 3 and the height (in metres) of the trees are as follows6 1 87 5 32 9 4 On the first column, Bunga can see two trees, as the tree on the third row is obstructed by the other trees. On the second column, Bunga can see…(Q1)This is a Data Structures problem and the programming language used is Lisp. Solve the question we detailed steps and make it concise and easy to understand. Please and thank you.When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error message
- 1.) Formula for cell A15 that adds all data from B1 to D6. 2.) Formula for cell A16 that determines the lowest number found on A1, A2, A3, B1, B2, and B3. 3.) If you had a cell reference C5, but in your formula you want C to stay constant and 5 to change, what would be the correct structure? 4.) If you have a list of numbers in cells B2 through B20 and you wanted the average of these numbers, what would be the formula? 5.) Assume you are copying cell A1 to cell C3. If cell A1 contains the formula =$B1+$C$1, how would this formula change when copied to cell C3? PLS ANSWER ALL THIS QUESTIONS NO NEED TO EXPLAINC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…C++ Coding: ArraysTrue and False Code function definitions for eoNum() and output(): Both eoNum() and output() are recursive functions. output() stores the even/odd value in an array. Store 0 if the element in the data array is even and store 1 if the element in the data array is odd. eoNum() displays all the values in an array to the console.
- Lab Assignment Question 2-Program in C++ to take input size of array from user and then take input values of array and store them in the array. Then print the sum of all elements in the array.Lab Assignment Question 3-Program in C++ to take input size of array from user and then take input valeues of array and print the sum of values at even index in the array only.In C LANGUAGE only Please
![C++ Programming: From Problem Analysis to Program…](https://www.bartleby.com/isbn_cover_images/9781337102087/9781337102087_smallCoverImage.gif)
![Microsoft Visual C#](https://www.bartleby.com/isbn_cover_images/9781337102100/9781337102100_smallCoverImage.gif)
![C++ Programming: From Problem Analysis to Program…](https://www.bartleby.com/isbn_cover_images/9781337102087/9781337102087_smallCoverImage.gif)
![Microsoft Visual C#](https://www.bartleby.com/isbn_cover_images/9781337102100/9781337102100_smallCoverImage.gif)