Translation begins with the_______ codon of mRNAand continues until a(n)_______ codon is reached. Individual amino acids are brought to the ribosome by______. These amino acids are linked into protein by _______bonds.

Translation begins with the___ codon of mRNAand continues until a(n)_ codon is reached. Individual amino acids are brought to the ribosome by. These amino acids are linked into protein by ___bonds.

Name: Translation begins with the_______ codon of mRNAand continues until a(
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Translation begins with the_______ codon of mRNAand continues until a(n)_______ codon is reached. Individual amino acids are brought to the ribosome by______. These amino acids are linked into protein by _______bonds.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Similar questions

The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
During the initiation of translation, the ribosome assembles on an mRNA strand with the start codon (AUG) positioned at the ____________ site, and the next codon positioned at the _____________ site.
The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and will signify _____
In the initiation of translation, the process always lines up at the start codon. What is the start codon? _______ What does the initiator tRNA do? The subunits of the ______________ then bind together around the mRNA and initiator tRNA.
All of the following are true about translation EXCEPT _____. as the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide when the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA Ribosomal subunits and a tRNA-carrying methionine converge on the start codon of an mRNA
Occurring in the nucleus ribosome mitochondrion , translation transcription is the process of making an RNA copy from a DNA template. The molecule then enters the cytoplasm. The process in which the mRNA sequence is converted into a sequence of amino acids is called translation transcription . In the cytoplasm, the nucleus ribosome mitochondrion reads the amino acid sequence and assembles the protein.
The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’ Circle the codon where translation (protein synthesis) by the ribosome will start. Put a box around the codon where it will stop. Use the genetic code table in your text to decode this message: what will be the sequence of amino acids in the protein?
An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
Translation occurs within the cell's _____________ and employs _____________ to manufacture _____________. Question 8 options: nucleus; the coding sequence of a gene; mRNA nucleus; ribosomes and a gene; tRNA cytoplasm; the coding sequence of a gene; mRNA cytoplasm; mRNA; proteins nucleus; mRNA; proteins
Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'
Use the codon sequence to translate the following mRNA sequence (start with the start codon - AUG - codes for methionine): mRNA sequence - AUGUAUAAGUAA [ Choose ] methionine, lysine, Stop, tyrosine 1st codon 2nd codon 3rd codon 4th codon
A small section of mRNA codons has the following sequence:UGG GAA ACC UUC Some Amino Acids Aspartate Glutamate Glutamine Isoleucine Threonine Methionine Asparagine Tryptophan Phenylalanine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.