Transcription produces O proteins from RNA. O proteins from DNA. DNA from RNA. O RNA from DNA.

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: What enzyme is responsible for forming peptide bonds between amino acids? Aminoacyl-tRNA synthetase.…

A: Translation is the process of synthesis of protein in the cytoplasm.

Q: Which of the following is responsible for the ability of one gene to code for more than one type of…

A: During RNA Splicing: Introns -excised and exons - ligated together.

Q: Which type of chemical bond is responsible for RNA-DNA base pairing during reverse transcription?…

A: The DNA and RNA nucleic acids that is composed of nucleotides. The nucleoitides are made up of…

Q: Replication of DNA begins at and transcription of RNA begins at

A: In DNA replication the double-stranded molecule of DNA is copied for making two identical DNA…

Q: The function of DNA gyrase in replication is to O open the duplex. stabilize DNA strands. synthesize…

A: Replication is the process of formation of a  duplicate copy of DNA strand. Replication involves…

Q: TRNA O is a type of RNA molecule. required for accurate translation. O all of the choices are…

A: Translation is the process by which the RNA molecule is read and translated into proteins. The three…

Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…

A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…

Q: Which of the following is true about heterogeneous nuclear RNA? it is more common in prokaryotes…

A: Ribonucleic acid (RNA) has several types in both eukaryotes and prokaryotes. The RNA can be a…

Q: During

A: Ans) During transcription, the coding strand is the same sequence as the newly synthesized mRNA…

Q: Codons are recognized by O DNA polymerase and a codon O FRNA and a codon O TRNA and an anticodon O…

A: Codon is a sequence made of DNA or RNA which corresponds to a particular amino acid.Genetic code is…

Q: Differences between DNA and RNA include which of the following? O RNA uses thymine O RNA is most…

A: Answer is none of these answers are correct.

Q: The "Central Dogma of Life" states that the pattern of information that occurs most frequently in…

A: Central dogma is the process that occurs in the lifecycle of cell through which information present…

Q: Which of the following is NOT a property of the genetic code? O It specifies the amino acids within…

A: The genetic code is the set of rules that govern how the nucleotide sequence of DNA is translated…

Q: Which of the following stretches of RNA is most likely to form a hairpin with 4 bases making up the…

A: A nucleotide (pentose sugar + nitrogenous base + phosphate group) is a phosphoric acid ester of a…

Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…

A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…

Q: The transmission of information is from DNA to RNA to proteins. Would it not be more efficient for…

A: The central dogma states that the DNA can replicate to form another DNA i.e. from parent to daughter…

Q: What happens during the process of translation? The cell uses information from messenger RNA to…

A: The expression of the genetic material occurs generally through the production of proteins. This…

Q: DNA transcription refers to? RNA synthesis  DNA repair DNA duplication Protein synthesis  DNA…

A: The objective of the question is to identify what process DNA transcription refers to in the field…

Q: What happens to the RNA primers found in newly synthesized DNA? Their nucleotides are converted to…

A: The making of DNA offspring from the parental DNA was termed DNA replication. During replication,…

Q: 18. The amino acid sequence is matched with three bases on mRNA codon or DNA codon (pick one). 19.…

A: Please follow step 2 for detailed explanation.

Q: Why is DNA not RNA the storage for genetic information?

A: DNA : Deoxyribonucleic acid is a genetic material for the storage of information. The structure of…

Q: RNA synthesis in eukaryotes and prokaryotes O occurs in the 3' to 5 direction. O none of the choices…

A: The synthesis of RNA is also known as Transcription. It is the process of converting or transcribing…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.