The splicing process a. occurs in prokaryotes. b. joins introns together. c. can produce multiple mRNAs from the same transcript. d. only joins exons for each gene in one way.
Q: a. Why are cells different from each other? b. How is a gene organized? (promoter, cis regulatory…
A: A cell is a fundamental unit of life. It is covered by the cell membrane and contains different…
Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…
A: Genetic code is a set of rules used by living organism’s cells in the process of translation that is…
Q: Match Column A with Column B. |Intron is removed from the MRNA transcript A 1st event v MRNA is…
A: Transcription is the mechanism by which mRNA is produced from template DNA in molecular biology. As…
Q: If a mutation deletes the promoter in a eukrayotic gene, which of the following most accurately…
A: mRNA means messenger RNA. mRNA forms from the template DNA strand. The template DNA strand is used…
Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…
A: Red blood corpuscles (RBC) are the cells that carry oxygen thorough out the body. They are small…
Q: How would you make a copy of DNA from an mRNA transcript and what is this molecule called?
A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…
Q: In gene silencing, the “dicer” enzymea. assembles siRNAs into a RISC complex.b. unwinds the RISC…
A: Introduction: Gene silencing is a mechanism to regulate the expression of genes. The gene silencing…
Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…
A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…
Q: During elongation (in transcription), RNA polymerase has three prominent channels, or grooves. These…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: For transcription to occur, the promotor region of DNA will a) Make a DNA copy of the DNA template…
A: RNA polymerase is the key central enzyme that regulates the transcription process. Prokaryotes need…
Q: Alternate splicing: A. Reduces mRNA half-life by shortening poly(A) tails B. Disrupts histone…
A: Introduction In Molecular Biology, RNA Splicing Is The Process By Which A Newly Synthesised…
Q: Post-translational modifications of proteins can affect which of the following? a. protein function…
A: When RNA has been transported to the cytoplasm, it is being translated into protein whose control is…
Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is…
A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the…
Q: The portion of the mRNA that is removed during splicing is (a) an inverted repeat (b) the promoter…
A: The protein synthesis is a process which involves two steps transcription and translation .…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: Because of the remarkable efficiency with which DNA molecules are introduced into cells, E. coli is…
Q: Initiation factors (IFs and eIFs) participate in the cellular process of ________________ . Question…
A: Spicing is removal of introns from a primary transcript. mRNA processing involves splicing , capping…
Q: Which of the following best describes tRNA? a. Provides the instructions for the amino acid…
A: Translation is the process of formation of amino acids from mRNA sequence.
Q: If you want to express a eukaryotic gene in a bacterial cell, you ned to (select all that apply):…
A: The gene is a basic physical and functional unit of heredity. Genes are made up of DNA.The gene is a…
Q: Which of the following statements about the DNA in one of your brain cells is true? (A) Most of the…
A: Answer is C.) It is the same as the DNA in one of your liver cells.
Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…
A: TRANSCRIPTION It is the process of transfer of sequence information from DNA to RNA . The DNA…
Q: The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b.…
A: Ans: RNA processing: The post transcription processing in eukaryotes is referred to as RNA…
Q: Which of the following is an example of a transcription factor? A) gene B) a repressor C) a…
A: A transcription factor (TF) (or sequence-specific DNA-binding factor) is a protein in molecular…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: A desired gene is defined as the insertion of copies of the gene into the living cells in order to…
Q: Transcription of genes starts at regions of the genome called
A: Transcription begins when an RNA polymerase binds to a so-called promoter sequence on the DNA…
Q: Which of the following functions is NOT typically attributed to small nuclear RNA (SNRNA)? A)…
A: Ribonucleic acid is a complex of the high molecular weight molecule that participates in cellular…
Q: A begins as a short segment of the double helix is unwound by A.The RNA polymerase binds to the…
A: Gene expression Gene expression is the process by which a gene is inside for its specific product.…
Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: Transcription is the process in which RNA is synthesized from DNA.
Q: The portion of a gene that will be expressed in a protein is called a(an) a. Exon b. Intron c.…
A: A gene is a segment or region of DNA (deoxyribonucleic acid) that encodes for proteins or regulatory…
Q: Proteins that influence RNA synthesis by binding directly to DNA are called_____ . a. promoters c.…
A: The conversion of the DNA into the mRNA is termed as the transcription and the conversion if this…
Q: Explain (in one or two lines) the function of the followings:(a) Promoter(b) tRNA(c) Exons
A: The process of DNA based gene expression in which a particular sequence of DNA molecules are copied…
Q: How would you make a copy of DNA from an mRNA transcript,what is this molecule called, and how would…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein…
A: Mutation can be defined as a change in the DNA sequence of a gene. In this case, a team of…
Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…
A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same…
A: mRNA transcription and translation occurs at same time in prokaryotes(polycistronic) while in…
Q: A release factor is referred to as a “molecular mimic” because its structure is similar to a. a…
A: Translation is a process of translating the sequence of messenger RNA molecule to amino acid…
Q: Promoters are DNA sequences a. near a transcription start site b. bound to a repressor protein c.…
A: it is related to molecular biology.
Q: Suppose you are studying two different mutations in a gene that codes for a protein. In the first, a…
A: Proteins are made up of amino acids that joins together by peptide bonds. The synthesis of protein…
Q: Which of the following would be present in a genome but not the transcriptome? (Select all) A)…
A: A transcriptome is the complete range of messenger RNA, or mRNA, molecules displayed by an organism.…
Q: If a splice site were mutated so that splicing did not take place, what would be the effect on the…
A: Mutation in genetic sequence of RNA is due to deletion, insertion, or any change in the nucleotides,…
Q: A regulatory region shows all of the following properties except
A: Ans - a) can be located in an exon. Regulatory regions cannot be present at the exon portion of a…
Q: A given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: ce between prokaryotes and eukaryotes gene expression c) state the importance of regulating gene…
A: Genes Genes are defined as nucleotide sequences on the DNA or RNA that specifies a functional…
Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…
A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…
Q: During RNA splicing
A: Answer: TRANSCRIPTION : It is the process of central dogma where DNA is transcribed in to RNA using…
Q: The anticodon … A. is complementary to the mRNA B. is found on the ribosome C. is found…
A:
Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…
A: NOTE:- As you posted multiple parts under one question, we will solve the first three for you, to…
Q: You know how the body using mRNA to create protein. Describe to someone how the cell will be able to…
A: mRNA vaccines instruct our cells about how to produce a protein that triggers an immune response…
Q: A regulatory transcription factor protein typically contains _________ that binds to the ________ of…
A: Transcription is the first step in central dogma of protein synthesis. It involves formation of…
Q: how does eukaryotic ribosome find the mRNA to be translated? A. the sigma factor B. the…
A: the 5' cap
The splicing process |
a. occurs in prokaryotes. |
b. joins introns together. |
c. can produce multiple mRNAs from the same transcript. |
d. only joins exons for each gene in one way. |
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following statements about the spliceosome is false? a. A spliceosome splices pre-mRNA molecules. b. A spliceosome removes exons from RNA molecules. c. A spliceosome is composed of snRNPs. d. A spliceosome recognizes the exon-intron boundaries and the branch site.During RNA splicing a. All exons are removed and degraded in the cell b. mRNA is made from DNA template c. Introns are removed from the mRNA and the exons are spliced together d. mRNA is translated into a protein molecule8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has been transcribed from DNA B. Converts a protein sequence to mRNA
- In prokaryotes, control of gene expression usually occurs at the a. splicing of pre-mRNA into mature mRNA. b. initiation of translation. c. initiation of transcription. d. All of the choices are correct.Alternate splicing: A. Reduces mRNA half-life by shortening poly(A) tails B. Disrupts histone arrangement for increased transcription C. Uses topoisomerase to complete its function D. Can produce 2 or more products from one geneThe function of the genetic code is toa. promote transcription.b. specify the amino acids within a polypeptide.c. alter the sequence of DNA.d. none of the above
- Genetic transcription is performed bya. ribosomes.b. RNA polymerase.c. DNA polymerase.d. helicase.e. chaperonesSome events that take place in proteins synthesis are shown below: A. An enzyme reads the gene surface B. A transcription factor bonds to a promoter site C. An mRNA molecule is produced D. The transcript leaves the nucleus E. An MRNA polymerase attaches to the template strand Which if the following shows the correct sequence? ACEDB ЕВАCD ОВАСЕ D EACAD О САВЕD О АВСЕD В АEDC ВЕАСD EABCDtRNAs a. carry amino acids b. bind to the anticodon present in the mRNA c. adapt the genetic information to the ribosome d. catalyze the peptide bond
- Shown below is diagram of RNA polymerase undergoing the process of transcription: This transcript: O Select one: a. None of these choices is correct. O b. has a sequence complementary to the top strand of the DNA. c. has a sequence identical to the top strand of the DNA. d. has a sequence complementary to the bottom strand of the DNA. e. has a sequence identical to the bottom strand of the DNA. f. It is not possible to determine, because not enough information has been provided. g. More than one of these choices is correct. MacEWhich of the following statements are NOT true? A. Replication is the process of making DNA and takes place in the nucleus of prokaryotic cells. B. Translation produces a polypeptide that may require additional processing to become a functional protein C. Transcription starts at the promoter of eukaryotic cells and scans until reaches the start codon. D. Splicing results in exons being put together and introns being removedThe portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b. introns.c. poly-A tails.d. 5′ caps.e. spliceosomes.