The significant mail advantages of Mail Merge are that the feature and in producing mass mailings in a simplified way, especially compared to preparing individual letters or envelopes, labels, postcards for many people. Fill in the blanks with the correct response. O A. Saves time and effort O B. Controls and creates files O C. Is better and richer O D. Helps to control and reproduce consistent files

The significant mail advantages of Mail Merge are that the feature and in producing mass mailings in a simplified way, especially compared to preparing individual letters or envelopes, labels, postcards for many people. Fill in the blanks with the correct response. O A. Saves time and effort O B. Controls and creates files O C. Is better and richer O D. Helps to control and reproduce consistent files

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Implement using Unity 1. Using the viewport, implementing the view port with different ability, save the file, Save the project, file management, path management, assets management. 2. Import the character as such from net and movement of the character in Unity. Following has to be typed in the word file and uploaded on the vtop for each and every exercise. a. Aim of the exercise b. Procedure (Step by step procedure) c. Screen Snap shot of the developed game d. Result e. Conclusion and suggestion for improvement
A small insurance company has an online application system that allows its customers to interactwith the business (e.g., log claims). Backups of the customers’ details are done on a spreadsheetdocument stored on Google drive. However, anyone who has access to the Google drive link ofthe file can view and modify all the customer details. On the backup, the system administratordoes not have visibility of the modifications made on the file. By analysing the scenario above, use the security design principles to criticise theoperations of the small insurance company and propose any two simple controlsthat could influence a good security program.
What exactly is BTD? What exactly is it? How can I add/remove/edit/ and how frequently should I do so? Requests for information Give an example to illustrate everything.
Can you please explain each of these commands with their meanings and like when and where they can be used against? git config git init git clone git add git commit git diff git reset git status git rm git log git show git tag git branch git checkout git merge git remote git push git pull git stash
What are the main similarties and differences between the concurrency, parallisim, and multiherding?Active Obect and monitor object are both widley used cuncurrency design pattern. They have some similarties, as well as, notable differnces. What are the general possible implementation of each one of them? Exaplain in details with examples.
Implement thread safe concurrent lock method without using any atomic method, mutex, semaphores, synchronized keywork without using Operating System Concept. Please modify below code such that it become thread safe without using Operating System concepts. I want solution for lock function to make it thread safe I also need code for the same
give An application that notifies the user when the stock price of a specific company changes could be an example of a watcher design.and go over several benefits of using the watcher pattern in the session design pattern.give An application that notifies the user when the stock price of a specific company changes could be an example of a watcher design.and go over several benefits of using the watcher pattern in the session design pattern.
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
Description: In this project, we develop a secure online application for storing a person's last wishes andall the secret information an individual would like to share with his/her successors. This includes anylogins and passwords from any social media tools, online banking applications, computers, phones, etc.If something happens, this information is typically extremely difficult to obtain. Many times, people passaway without leaving any notes on their property and any relevant information that they wish theirsuccessors know afterward -How much will they be charged and how will it be paid: The service will charge an annual subscriptionfee, which will vary depending on the types and the variety of the assets kept in the vault as well as thevolume of those assets (if media). The price of subscription will also range depending on the users’ ageand the level of access security and the types of the triggers used to release the information to potentialsuccessors or other designated parties.…
Correct answer will be upvoted else downvoted. Computer science. You can change an exhibit utilizing the accompanying advances quite a few times: Pick two files I and j (1≤i,j≤n), and an integer x (1≤x≤ai). Leave I alone the source file and j be the sink file. Reduction the I-th component by x, and increment the j-th component by x. The subsequent qualities at I-th and j-th file are ai−x and aj+x separately. The expense of this activity is x⋅|j−i|. Presently the I-th file can at this point don't be the sink and the j-th file can at this point don't be the source. The all out cost of a change is the amount of the multitude of expenses in sync 3. For instance, exhibit [0,2,3,3] can be changed into an excellent cluster [2,2,2,2] with absolute expense 1⋅|1−3|+1⋅|1−4|=5. An exhibit is called adjusted, if it very well may be changed into an excellent cluster, and the expense of such change is particularly characterized. As such, the base expense of change into a…
The objective is to make sure we are able to set up their own GIT repository and are able to navigate using basic commands. Please use at least 3 basic commands, take a snapshot and provide a brief explanation of the commands used(1-2 sentences). 1. Create any java program correctly and have it in your GIT repository. a. Steps for begin with the installation of GIT repository b. Include snapshots of(at least 3) performed by GIT commands from your program c. Provide brief explanation of each command below its snapshot
Familarize yourself with the commands cat, cut, tail, less, head, join, paste, nl, sed, grep, wc, sort, uniq, split. Prepare text files: - file test.txt with arbitrary text (see Appendix) - copy /etc/passwd file to the home directory cp /etc/passwd ~/pass.txt - file city.txt (see Appendix) Use the command line to complete the tasks: - Print files test.txt, city.txt and pass.txt - Print number of (A) in the files test.txt, city.txt and pass.txt - Print (B) from each line of pass.txt. Fields in the lines are separated with a colon. - Print (C) lines of the file pass.txt - Print city.txt sorted in (D) direction - Print city.txt replacing (E) - Print lines which (F) from city.txt - Split city.txt into several files, 3 lines per file