The organelle shown is used by plants to carry out photosynthesis. What is the name of the organelle? - A Mitochondria B) Cytoplasm Cell membrane ) Chloroplast

Q: Identify the eukaryotic organelle that contains 3 membranes, a water soluble compartment for Calvin…

A: Photosynthesis is the process by which green plants use sunlight to synthesize nutrients from carbon…

Q: Which of the following are the major component of chloroplast membrane of plants and are absent from…

A: In green plants and eukaryotic algae, there are specialized cells organelles that absorb sunlight…

Q: uring cellular respiration in procaryotic cells where is the electron will transport? 1) plasma…

A: The answer of the question is below,

Q: Do onion cells have chloroplasts? Explain.

A: Plastids are double membraned cell organelle found only in plant cell. They help in photo synthesis,…

Q: Which of the following acts as a passive electrical insulator?a) Myelin sheathb) Plasma membranec)…

A: An electrical insulator is a material in which the electron does not flow freely or the atom of the…

Q: The origin of the photosynthetic eukaryote took place when a ______ was engulfed by a later…

A: Answer : The origin of the photosynthetic eukaryote took place when a ______ was engulfed by a later…

Q: This is a leaf from Elodea, an aquatic plant. The arrows are pointing out chloroplasts. The field of…

A: The leaf of the elodea in aquatic plant have the chloroplast of the diameter  75 um then each of the…

Q: In the Prokaryote and in eukaryotes, the chemical reaction (Glucose à 2 pyruvate molecules)…

A: Photosynthesis is a physio-chemical process by where green plants use light energy to synthesize…

Q: 22) A repressor is used by the cell to regulate: a) The Calvin Cycle b) The Krebs Cycle c) The…

A: Millions of billions of cells make up the human body. They help in absorbing nutrients as well as…

Q: The inner membrane of the mitochondria is analogous with which of the following in the chloroplast:…

A: The question is asking us to identify the part of the chloroplast that is analogous, or similar in…

Q: Which of the following statements is correct? a) Chloroplasts are only found plants O b)…

A: The following statement is correct.

Q: Where does glycolysis take place in eukaryotic cells? A) mitochondrial matrix B) mitochondrial…

A: Eukaryotes are the organisms in which nucleus id developed and is surrounded by a membrane. In these…

Q: From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to…

A: BLAST (Basic local alignment search tools) is online algorithm and program to compare the biological…

Q: Cellular Respiration] Among the glycolysis products, which will most likely to make a high net…

A: Cellular respiration occurs in four stages- in the first step glycolysis occurs where glucose is…

Q: Which organelle is involved in conversion of pyruvate to acetyl coa? Stores dna and is the site…

A: A eukaryotic cell is characterized by various cellular components and biomolecules. Each cell…

Q: What is true of oxidative phosphorylation? a) It can occur only in the presence of oxygen. O b) It…

A: The final stage of cellular respiration is oxidative phosphorylation. It involves the transfer of…

Q: Vhich structure is unique to the chloroplast? a) Inner membrane b) outer membrane c) Thylakoid, d)…

A: Thylakoid membrane system  Thylakoids are membrane bound compartments in the chloroplasts of all…

Q: Within the eukaryotic cell, the source of most of the energy stored in ATP is produced through the:…

A: Introduction - Organisms with a nucleus and other membrane-bound organelles are known as eukaryotes.…

Q: Name two similarities in the structure or function of chloroplasts and mitochondria. Name two…

A: Chloroplast, and Mitochondria are organelles found in living organisms' cells that perform vital…

Q: ATP is : A) produced in the mitochondria of cells B) produced in the nucleus of cells C) produced…

A: correct option is A ) produced in the mitochondria of cell.

Q: Which taxon is most closely related to Mitochondria

A: In eukaryotic cells, the mitochondrion is an extremely fascinating and significant organelle. It is…

Q: Illustrate the relationships among the membranes and compartments of (a) mitochondria and (b)…

A: Cell organelles can be described as the organs located in living cell’s cytoplasm. Organelles of…

Q: Draw neat diagrams of chloroplast and mitochondria label the parts indicating the products (glucose…

A: The mitochondria is an organelle that is found in the cells of most eukaryotes, such as animals.

Q: What form of energy does a solar cell covert sunlight into ? A) thermal energy , B) electrical…

A: Solar panels actually comprise many, smaller units called photovoltaic cells. Solar cells are very…

Q: What macromolecule would NOT be created if all chloroplasts were removed from a plant cell? *

A: Plants prepare food by the process of photosynthesis. In this process plants prepare food from…

Q: eukaryote cell typically has enough available ATP to meet its needs for about 90 seconds. What would…

A: Eukaryotes are life forms whose cells contain a nucleus and other membrane bound organelles. There…

Q: Breifly explain how a chloroplast structural protein is built, modified, and transported to the…

A: Most nuclear-encoded chloroplast proteins are synthesized on cytosolic ribosomes as larger…

Q: 27) In a single-celled organism, which would you predict to be enclosed within the greatest total…

A: This question is belong to cell- Biology.

Q: Do plant cells have mitochondria? Explain.

A: Photosynthesis is a process by which carbon dioxide and water are broken down to produce glucose…

Q: ts explain the existence of mitochondria and chloroplasts with the endosymbiotic hypothesis. What is…

A: Endosymbiotic hypothesis tries to explain the origin of mitochondria and chloroplast .

Q: Why do chloroplasts move?

A: Chloroplasts are subcellular organelles (plastids) of plant cells generally considered to be derived…

Q: A researcher analyzed a sample of cells and found that they contain cellulose, the primary molecule…

A: Cellulose is a polysaccharide made up of linear glucan chains bound together by β-1,4-glycosidic…

Q: What role does a mitochondrion play in a cell? a) It has a role in photosynthesis. b) It…

A: Introduction  Mitochondria are organelles found in most eukaryotic cells, which are the cells that…

Q: Where does electron transport during cellular respiration take place in procaryotic cells? a)…

A: To identify Where does electron transport during cellular respiration take place in prokaryotic…

Q: Which of the following does not occur in the mitochondria? A) Krebs cycle C) glycolsis D) electron…

A: Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the…

Q: Which of the following is NOT true about the structure of chloroplasts? A) The thlakoid membranes…

A: Given: Plastids are double membrane bound organelles and easily observed under microscope as they…

Q: Draw a simple diagram of a mitochondrion and identify its structural features.

A: The mitochondria is a double membrane bound structure which is found in most eukaryotic organisms.…

Q: 1. The energy required for ______________  reactions comes from _______________ reactions.   a)…

A: b)   Interphase is not a phase of mitosis

Photosynthesis

Plants have a capacity that we humans can only imagine— the ability to produce food from sunlight. Sure, we can prepare some dishes that we can savor on, but it become possible because of the plants (as they serve as a producers of all the raw materials required). Photosynthesis is the method of assembling carbohydrates with the aid of sunlight.