The mechanism of action of Sodium glucose co-transporter 2 inhibitors is to increase urinary glucose excretion. True O False
Q: Question 5 of 10 Among the given statements, which one(s) is/are correct about alpha keratin? 1. It…
A: Alpha-keratin is a protein found in vertebrates. It is found in nails, hairs, claws and epidermis of…
Q: Draw 9:51 am / Draw 9:51 am / -u deleted this message 9:51 am What are the Amino acids and the…
A: Amino acids are biomolecules that are composed of an alpha carbon bonded to 4 groups. They are; a…
Q: 4. structure of a monoacylglycerol (MAG) 5. structure of the product of the reaction catalysed by…
A: Lipids are mainly found as triacylglycerols. These have glycerol molecule esterified to three fatty…
Q: Name the class.
A: In a biological hierarchy, the class is a taxonomic level; that is, it is a taxonomic unit in that…
Q: Please draw 2 diastereomer of the following molecule
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Isomers are…
Q: Define the term motilin?
A: The digestive system is made up of the gastrointestinal tract and the accessory organs of digestion…
Q: What do you mean by Nissl's granules?
A: Nissl's granules are part of neurons. They perform very important functions and hence is vital for…
Q: 0 || CH₂▬0—C—CH₂(CH₂) 13CH3 O || CH-O-C-CH₂(CH₂) 13CH3
A: The two fatty acyl chains are present in this molecule through ester bonds. These fatty acyl chains…
Q: To maximize the speed with which action potentials travel through the nervous system, which is the…
A: (B) option is correct answer. action potential travels faster if out myelin sheath is stronger and…
Q: Adenine always pairs with
A:
Q: NUCLEIC ACID "BASE PAIRING" 1. 5'-A-T-A-A-G-G-G-G-C-T-C-3' 2. 5'-G-G-G-G-C-T-A-C-T-C-3'
A: The nucleic acid base pairing follows simple rule A pairs with T while G pairs with C i.e purine…
Q: Write a short note on nonstandard amino acids.
A: introduction: The below answer provides an explanation of nonstandard amino acids, which are amino…
Q: Read througn the follOwing sentences, fill in the provided blanks, and highlight or bold cholce. a.…
A: Glycolysis means the splitting of glucose. The first step of the process occurs in the cytoplasm of…
Q: Which of the following have the complete information about the fatty acid? он
A:
Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…
Q: List three important distinctions between fibrous and globular proteins.
A: Fibrous proteins and globular proteins are the two primary types of the protein's tertiary…
Q: Identify the highlighted structure
A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…
Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…
A: Protein sequencing is an important aspect in the field of proteomics and molecular biology which…
Q: 9) Label highlighted nerve in the box 10) This nerve belongs to the
A: The given diagram shows an image of the hip region and the highlighted nerve which exits from the…
Q: Show where trypsin and chymotrypsin would cleave the following peptide…
A: Amino acids are joined together by a peptide bond to form a polypeptide chain called protein.…
Q: Which amino acids are in the figure?
A: Amino acids are the building blocks of proteins. They are organic compounds made up of an amino…
Q: Stiffening of the arteries, joints, and lensesin old age may be a result of cross-linkingbetween…
A: Collagen is the most important structural protein in the extracellular matrix, and is present in all…
Q: What is nucleus acid?
A: Nucleic acid is a significant class of macromolecules found in all cells and infections ( virus).…
Q: 4B. The hormones produced by this gland are: A
A: Pancreas is an organ that is located in the abdomen. Its major role is to conver the food intake…
Q: 11 Endocrine glands are often called "ductless glands" because their products are secreted directly…
A: Endocrine glands secrete hormones. Hormones are secreted from one gland and activates the functions…
Q: explain this figure
A: Amino acids are organic molecules that contain a basic amine group (-NH2) and a carboxyl group…
Q: Define the term TENS?
A: The term TENS is related to the nervous system. A nervous system is a collection of neurons and…
Q: Why does hematoxylin stain cartilage?
A: Hematoxylin is the principle tissue stains used in histology. It is a complex of aluminium salt and…
Q: 4 6、そー 25a
A: Bony skeleton provides points of attachment for skeletal muscles. The skeletal muscles contract to…
Q: Define beta (b) sheet
A: Proteins have different organization levels, which gives the properly folded functional form of the…
Q: Does "end A" represent the plus or the minus end? Explain. "A" End
A: End pA represent the plus end.
Q: 1. What is the possible identity of the amino acid? [ Select] V 2. What is the isoelectric point of…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: Spinal fluid contains 15 to 45 mg/dL protein. If you were to take a 5.0 mL sample of spinal fluid,…
A: Proteins present in spinal fluid is low in amount and small proteins as compared to blood serum.
Q: Give the complete name of the peptide below.
A: A peptide is a molecule that contains two or more amino acids linked together via peptide bonds. A…
Q: Anyone know these three Blood. Cells?
A: White blood cells (leukocytes) don't have a well-defined shape because their shape is continually…
Q: 10.12 2. What is the clinical significance of ALT?
A: Alanine aminotransferase, or ALT, is an enzyme that is mostly found in the liver. ALT's purpose is…
Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H. H,N-C-COOH…
A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building…
Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?
A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…
Q: what is lab value of creatinine
A: Creatinine is the breakdown product of creatine phosphate from muscle and protein metabolism .Serum…
Q: The following lipids contain sphingosine as the alcohol backbone EXCEPT O Cerebroside O Ganglioside…
A: Sphingosine is composed of an amino alcohol head group, with two hydroxyls, and one amino group…
Q: Uracil (U Adenine HN 3 H- HO-P-0-P~0-P 0-CH, o-P H H. H H. 5 H OH OH он он 2 O-a-or O-a-or O-a-Or
A: Nucleic acid was first discovered by Fredrich Miescher from the nuclei of the pus cells (leukocytes)…
Q: Define allosteric effect
A: In human physiology, the term allosteric means change in shape or activity of a protein (majorly…
Q: IUPAC name for the structure given. (DO NOT write "cis or trans") * ннннн ннн ннннн…
A: Systematic names given to a chemical structure is known as the IUPAC name. IUPAC stands for…
12.
Step by step
Solved in 3 steps
