The following psuedocode below is best described as an example of if (y is not equal to 0): z- x/y else z -0 o compilation O iteration selection O sequence The basic building blocks of algorithms are: O and, or, not, exclusive or sequence, selection, iteration <=, >», != O &&, ||.! O procedures, parameters, and methods

The following psuedocode below is best described as an example of if (y is not equal to 0): z- x/y else z -0 o compilation O iteration selection O sequence The basic building blocks of algorithms are: O and, or, not, exclusive or sequence, selection, iteration <=, >», != O &&, ||.! O procedures, parameters, and methods

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Algorithm Development Course, Could you please help me to find out what is the answer to this question!
____ is the simplification of an algorithm’s runtime to its greatest term, giving us a function that describes the functions worst case relative growth.
TASK 1. Variables. Review variables, Implement the following code, make sure it runs without errors. Change Summation Integers problem to Finding the minimum problem.
An algorithm that has been constructed effectively should not include any ambiguity. briefly describe
Problem-39 Write a recursion formula for the running time T(n) of the function whose code is below. def Function3(n): if n <= 0: return for i in range(0, 3): Function3(0.8 n) This loop executes 3 times with recursive value of n/3 value Function3(20)
Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACT
Java program WAP to find the compute quotient and remainder from dividend and divisor that should be taken from user
There's an error to this code when I run it in google collab # objectives: 1) demonstrate numerical differentialtion, # and 2) illustrate results graphically. import numpy import math from numpy import arange, cos import matplotlib.pyplot from matplotlib.pyplot import * # A general function for calculating the slope between two points: x and # x+delta. def der(x,delta): delta = float(delta) if delta < (0.0000001): print ('Value chosen for delta is too small.') return 1/delta else: slope = (f(x + delta) - f(x))/delta return slope # Define the function y=100e^(-0.0482t) def f(x): f = (100.0**(-0.0482*x)) return (f) point = 2.0 #This is a point at which a derivative will be calculated. # The following statements initialize variables for computation. number = 510 increment =10 y = [] x = [] figure() f=[3,-4,-12,0,2] print ('\nFunction') print (f) print ('\nFirst Derivative') g= f.deriv(m=1) # First…
Define the terms sentinel, break, and continue that are used in loop structures. Write in complete sentences
When an algorithm that normally recursively calls itself will no longer do so, what are the conditions that must be met?
Count divisibles in range def count_divisibles_in_range(start, end, n): Let us take a breather by tackling a problem simple enough that its solution needs only a couple of conditional statements and some arithmetic, but not even one loop or anything even more fancy. The difficulty is coming up with the conditions that cover all possible cases of this problem exactly right, including all of the potentially tricksy edge and corner cases, without being off-by-one. Given three integers start, end and n so that start <= end, count how many integers between start and end, inclusive, are divisible by n. Sure, you could solve this problem with the list comprehension one-linerreturn len([x for x in range(start, end+1) if x % n == 0]) but of course the automated tester is designed so that anybody trying to solve this problem in such a blunt fashion will only find themselves running out of both time and space! Your code should have no loops at all, but use only integer arithmetic and…
JAVA algorithm ur pseudo-code ,, top-down, stepwise refinement. Write a Java program.. Baker Co pays commision. Salesppl get $200 a wk nd 9% of their gross sales per wk. You’ve been supplied with a list of the items sold by each salesperson. The values of these items are in pic, app inputs one 1 sale ladys items sold for last wk and calculates and shows her earnings. She can sell any amnt