The California Spiny Lobster (Panulirus interruptus) belongs to which of the following groups (taxa)? (select all choices that are correct) OMerostomata OChelicerata O Lophotrochozoa Arthropoda Annelida Protostomia Pancrustacea Ecdysozoa

Q: Reproduction is usually secual with both male and female sexes, however asexual reproduction does…

A: Parthenogenesis is the type of asexual reproduction involving the development of female gametes…

Q: QUESTION 6 A population's carrying capacity (K) is the size at which the population O is the largest…

A: Here we provide a brief explanation of carrying capacity of a population.

Q: On the right of the replication fork, which DNA strand (top or bottom) will be the template for…

A: Okazaki Fragments these are short stretches of DNA produced by a discontinuous synthesis of the…

Q: Describe the major climate during your time era. Climate mainly includes average temperatures  and…

A: Climate:- Climate is defined as conditions prevailing in an area for a long period of time.

Q: What are the concepts behind osmosis and enzymatic browning in potatoes?

A: Osmosis is the movement of water or other solvents across a semi permeable membrane from a region of…

Q: Please make a conclusion for this, thank you so much! :) An ear of corn has a total of 381 grains,…

A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is…

Q: number 32

A: Linked genes  The genes are said to be linked if they are tend to pass together in sperm of egg.

Q: specific strategies used by health professionals patients, and the general public to prevent…

A: Antibiotics are the drugs(medicine ) used to treat the bacterial infection. There are so many…

Q: 2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they…

A: Introduction :  Through transcription process RNA synthesized from DNA. After that RNA processing…

Q: Describe the most significant hormones responsible for sex differentiation. List the most important…

A:

Q: What will the K limited population size of this coyote population be at the next time step (2023) if…

A: After the population gets doubled, there is a check to the population because of limiting factors.

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: 14 15 16 8 10 12 6. 13 17 10 11 Male Female

A: Male :  * 1 is kidney * 2  is renal vein * 3 is ureter  * 4 is renal artery * 5 is testis  * 6 is…

Q: When Replacement of the original gene occurs ?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: What characteristic is considered as plesiomorphic? Explain your answer.

A: Introduction Plesiomorphy:- An ancestral or evolutionary trait that is shared by some or all members…

Q: The genes that codes for the creation of certain blood groups are located on chromosome "XGp22.3",…

A: *Chromosomes can be found in nucleus which are thread like structures located present in both…

Q: Cardiology

A:

Q: Which of the following would not involve part of the appendicular skeleton? O taking this test O…

A: The skeletal system in humans is composed of 206 bones and a few cartilages. These are grouped into…

Q: 7. Aspartic acid has a side chain bearing a carboxylic acid group; its pK, is 4. The a-amino and…

A: Ans. 7) The pKa values tells us about the strength of an acid.

Q: 9. The response of wild mustard to drought in the bay area shows?? a. There is genetic variation for…

A: The correct option is D.

Q: 34. If all living things are able to improve their survival chances when exposed to new…

A: B is the correct option.  This property is called, adaptation, where an organism adapt some changes…

Q: The following results were obtained from a disk diffusion test for microbial susceptibility to…

A: Zone of inhibition of an antibiotic shows its effectiveness. It is termed as the area or space where…

Q: 6. Assume height in a particular plant to be determined by 2 pairs of unlinked polygenes, each…

A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: Compare the overall body structure of the cave fish and the minnow below. cave fish minrow 1. What…

A: Cave fishes  These fishes are called so because they have adapted themselves to live in caves and…

Q: Type of Dermal Scale Cosmoid Placoid Shark Tooth Ganoid Cycloid Ctenoid Mammalian Tooth To compare…

A: Introduction  cosmoid scales have hard enamel, inner layer of cosmine , and vascular bone layer.…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: Describe the common mode of reproduction in Angiosperms

A: The reproductive parts of a flower are represented by the stamens and pistils. It is made up of a…

Q: Which one of the following is not associated with transcription? * O sigma factor O hairpin loop…

A: Transcription is a process of making a RNA copy from sequence of DNA.

Q: These are the specific name of an independent taxonomic group of any rank.  A. Character B.…

A:

Q: Why is the gap junctions between heart muscle cells play a relevant role in producing a regular…

A: Only the heart contains cardiac muscle tissue. Cardiac muscle contractions are well-coordinated,…

Q: 1. What is the function of DNA helicase in DNA replication? a. To create replication bubbles by…

A: Helicases are enzymes that catalyse the separation of duplex nucleic acids into single strands in an…

Q: a. What role do miscellaneous structures (where applicable) play in the organism's role for…

A: INTRODUCTION External structures are the outer covering all all the livings organisms which provides…

Q: What are the different groupsof fungi?

A: Introduction In this question we will discuss about the different groups of fungi.

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…

A: Solution Lowest weight = 5 lb Highest weight = 29 lb Weight difference = 24 lb 3/768 = 1/256 Four…

Q: Describe how the generation of functional beta cells from stem cells requires an extensive knowledge…

A: Beta cells produce insulin, a hormone that regulates the amount of glucose (a form of sugar) in the…

Q: How do mitochondrial proteins interact with IAPs to prevent inhibition of apoptosis?

A: Multicellular organisms experience apoptosis, which is a type of programmed cell death. Cell death…

Q: What are taxonomic aids? Mention some of the taxonomic aids for identification.

A: Taxonomy is the science of naming, describing, classifying organisms. The father of Taxonomy is Carl…

Q: 1.Transcription factors (TFs) bind to promoter sequences on DNA because the shape of DNA at that…

A: Transcription is a part of central dogma, in which the DNA molecule is converted into mRNA by…

Q: Select all examples of DNA transformation Check All That Apply Transfer of DNA through a pilus into…

A: The process through which an organism receives external DNA is known as transformation. There are…

Q: Because of the constant exchange of blood calcium and bone calcium, the concentration of calcium…

A: The calcium concentration in the blood is tightly regulated because of the importance of calcium for…

Q: What are first-generation methods (the Sanger technique and capillary electrophoresis) ?

A: Sequencing is a term used in biology and genetic to describe the process of determining the main…

Q: Choose one component of the innate immune system and explain how it is beneficial. This can be part…

A: Immunity that is innate or nonspecific is a protective mechanism that an individual is born with. It…

Q: In an investigation of fruit fly behavior, an enclosed choice chamber was used to test whether the…

A: A spatial distribution is a graphical representation of a phenomenon's distribution throughout the…

Q: A benefit/benefits of vaccination is that a child will O protect other children who cannot be…

A: Answer : the benefits of vaccinations is that Child will are :    develops antibodies through…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: Introduction :  4 alleles control coat colour of guinea pig  Black = B  Sepia = S  Cream = C  Albino…

Q: 1. Look again at the six embryos in their earliest stages. Describe the patterns you see. What…

A: Species and their anatomical changes from early stage to late stage. Human : well developed limbs ,…

Q: O Variolation had high infectious (10%) and death rates (up to 3%). Vaccination was much safer and…

A: INTRODUCTION  Variolation was an old method used for immunize infected persons against some deadly…

Q: The evolution of beak size in the various species of Galápagos finches is associated with their (a)…

A: Introduction:- The cumulative changes that occur in a population over time are referred to as…

Q: 6. Which are greenhouse gasses? Carbon Dioxide CO, Methane CH Nitrogen N, oxygen O2 water H.O

A: Introduction:  Gases which absorb and emits radiant energy with the thermal infrared range that…

Q: What is true of linked genes? Choose all that apply: pts deducted for including incorrect answers…

A: Linkage explains why some traits are typically passed down in families. Because the genes for hair…

Wound infections

A wound is damaged or breaks in the surface of the skin. The wound is divided into two types, they are acute wound that includes minor cuts, laceration, bites, etc, and chronic wounds that can become slow to heal including ulcers on the legs and feet. Redness, pain, and swelling are signs of a wound.