The allergic response is caused by ___ that secrete large amounts of allergens bind to , --- when OMast cells; histamines; IgE antibodies Neutrophils; histamines; antigens O Neutrophils; antibodies; antigens Mast cells; antibodies; histamines

Q: Why is it 2n-2?

A: A molecule is called chiral molecules if it cannot be superposed on its mirror image by any of A…

Q: 8 What are the three components of anucleotide?

A: Nucleosides are a combination of a nitrogen base with pentose sugar. The nitrogen base combines with…

Q: Draw 9:51 am / Draw 9:51 am / -u deleted this message 9:51 am What are the Amino acids and the…

A: Amino acids are biomolecules that are composed of an alpha carbon bonded to 4 groups. They are; a…

Q: What do you mean by Nissl's granules?

A: Nissl's granules are part of neurons. They perform very important functions and hence is vital for…

Q: identify the question being asked   IUPAC name for C16:0

A: The IUPAC nomenclature of organic chemistry is a technique of naming organic chemical compounds that…

Q: The solid black line represents the backbone of the protein. Functional groups 1 and 2 are [ Select]…

A: Q. The solid black line represents the backbone of the protein. Functional groups 1 and 2 are    •…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: What is BP ? My BP is 100/150 . is it good or bad for my health ?

A: KEY WORDS :- BP - Blood pressure. Normal blood pressure - 120/80 MMHG.

Q: If N<k, the value of r is negative and the population declines. Natural populations may grow at…

A: The equation for logistic growth is: dN/dt = rN (K-N)/K When N&lt;&lt;&lt;&lt;K Which means…

Q: Identify the highlighted structure

A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Protein sequencing is an important aspect in the field of proteomics and molecular biology which…

Q: 9) Label highlighted nerve in the box 10) This nerve belongs to the

A: The given diagram shows an image of the hip region and the highlighted nerve which exits from the…

Q: A B C (b) [Choose ] [Choose] [Choose ] <

A: The peripheral nervous system of the body consists of several nerves and ganglia, which play an…

Q: Show where trypsin and chymotrypsin would cleave the following peptide…

A: Amino acids are joined together by a peptide bond to form a polypeptide chain called protein.…

Q: Which amino acids are in the figure?

A: Amino acids are the building blocks of proteins. They are organic compounds made up of an amino…

Q: What is nucleus acid?

A: Nucleic acid is a significant class of macromolecules found in all cells and infections ( virus).…

Q: Which peptide would absorb the most UV light at 280nm? (Can you show work because I mainly want to…

A: Aromatic amino acids are relatively non polar.  All aromatic amino acids such as tyrosine,…

Q: Define beta (b) sheet

A: Proteins have different organization levels, which gives the properly folded functional form of the…

Q: What is centriole ?

A: Centrioles are paired barrel-shaped organelles located in the cytoplasm of the animal cells near the…

Q: 28. How do medical asepsis and surgical asepsis differ?

A: Medical refers to the field of knowledge, practice, and study related to the diagnosis, treatment,…

Q: Describe lysine degradation.

A: The amino acid is an organic acid that contains an alpha carboxyl group, alpha amino group, a…

Q: Does "end A" represent the plus or the minus end? Explain. "A" End

A: End pA represent the plus end.

Q: Give the complete name of the peptide below.

A: A peptide is a molecule that contains two or more amino acids linked together via peptide bonds. A…

Q: What is the K-T Boundary?

A: This boundary is a geological signature,  usually a thin band of rock. This boundary basically marks…

Q: 510. Trypsin cleaves proteins after lysine and arginine residues. Trypsin itself has 13 lysine and 2…

A: By cleaving peptide bonds in the protein sequence, protease catalyzes the hydrolysis of proteins…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: Which structure is highlighted?

A: According to our guideline we can answer only the first question. So, upload the second image…

Q: Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent…

A: AThe rearrangement in scenario A is a tandem duplication, where the duplicated segment GH is…

Q: Why is cholesterol an important steroid?

A: We can say that Cholesterol is a fatty substance that is synthesized by the liver and is circulated…

Q: Draw serine

A: Those organic molecules which possess two functional groups carboxylate and amino group and a…

Q: 15 Explain why detergents, which have an amphipathic structure like bile salts, are able to remove…

A: Detergent- These are the powder that contains chemical properties and are used for the removal of…

Q: Define allosteric effect

A: In human physiology, the term allosteric means change in shape or activity of a protein (majorly…

Q: a. Construct a typical wax derived from palmitic acid. No sticks are acceptable. CH2 groups can be…

A: Waxes are esters of long-chain fatty acids and monohydroxy alcohols. They are highly insoluble. The…

Q: What are siRNAs?

A: The gene is a basic physical and functional unit of heredity. Genes are made up of DNA.The gene is a…

Q: CH, H H ОГТІ 0= II Т Н H-C- H₂C-N-C-C-O-P-OC-H CH, H H О 1 H-C-0 -Т Н 2 онннн Н II ТТГ Н Н Н Н Н Н Н…

A: A molecule is the smallest part of any substance that is made up of different atoms connected…

Q: (i) Why does DNA contain thymine instead of uracil? Justify.

A: Thymine and uracil are the pyrimidines present in DNA and RNA molecules respectively. Thymine…

Q: 8 sources of monosaccharaides

A: Ans: Monosaccharaides: The simple form of sugars which only has one oxygen as well as two hydrogen…

Q: 5. What kind of joint is found in these skull bones? 6. What kind of joint is found at this…

A: Skeletal system is divided into two parts namely, axial skeleton and appendicular skeleton. Axial…