Table 13.5. Comparison of vertebrate characteristics. Agnatha Chondrichthyes Osteichthyes Amphibia Reptilia Aves Mammalia Number of Paired Appendages Number of Heart Chambers Type of Respiratory Structure Excretory Product Type of Body Covering

Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…

A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…

Q: From the choices below, which are reputable sites that can be used to locate scientific journal…

A: Science is a term which is used for the study of the subject which is based on the facts and…

Q: Obesity is an extremely difficult problem to resolve for the people affected. Bariatric surgery,…

A: As per Bartleby's guidelines, we cannot answer more than one question and more than three subparts…

Q: Horny legged beasts The Horny legged beasts are known for their highly variable horn size and leg…

A: As per the guidelines, we are supposed to answer only first three subparts in question posted with…

Q: The photomicrograph below shows mitotically dividing cells from whitefish (Coregonus lavaretus). a.…

A: Mitotic division: it is also known as equal division because each daughter cells have a copy of…

Q: _1. Digestion is a complex process involving specialized anatomical and physiological adaptations…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Label the Eye 14 1 13 2 3 12 11 10 4 5 9 6 7 8

A: The eyes are the sensory organs that allow us to see and perceive visual stimuli. This visual…

Q: A. Chromosomes move and align themselves at the center of the cell. B. The sister chromatids of each…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Digestive Enzyme Activity Tan-protease ...... - W-protease --- 4 8. 10 12 pH Based on these data and…

A: In this question, scientist identified two enzymes which are found to function in the digestive…

Q: Name: Ch 6 Crossword Try to answer as many as you can without your notes. Have fun! Created using…

A: The human body is a well built machine in which all the organs coordinate together to make it work.…

Q: 1. =lemg/ The order is for 200 mg. The label reads 250 mg/5ml. You would give ml The order is for…

A: Given: Order for 200 mg, Label: 250 mg/5ml. To Find: Amount in ml.Given: Order for 500 mg, Label: 1…

Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…

A: Introduction: Complementarity is the fundamental concept of DNA replication and transcription since…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: Learning Task 1 Monohybrid Crosses Answer the following monohybrid crosses: 1.A plant can produce…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: In the phylogenetic tree below, character 3 is a: 44+B 1 5 3 C O Ancestral trait O Uniquely derived…

A: Introduction :- Phylogenetic trees represent hypotheses regarding a set of organisms' evolutionary…

Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…

A: This question is about interpreting a scatter plot with a regression line from an experiment that…

Q: Now that you have learned about respiration and photosynthesis, how do aerobic respiration,…

A: Water is necessary for transpiration, photosynthesis, and respiration in order for plants to grow…

Q: Q1: Select appropriate associations/definitions between rows and columns a marker for Indicator of…

A: A serological test is performed to diagnose the presence of antibodies for a disease. The antibodies…

Q: Answer the following questions: 1. What is the difference between schizocoely and enterocoely?

A: Solving the first part, please send the next questions saperately.

Q: 4. Color code the bones that are similar in each animal using color pencil or crayons. 5. Identify…

A: Certain organs will have similar functions and structure among various organisms, but with a…

Q: SUGAR AND WATER EXPIRIMENT 1. Make sure the glasses have an equal amount of water. Put a sugar cube…

A: Water  It is the most important material on the planet eart. Water makes life possible as almost…

Q: Cancer usually begins in the bronchi or bronchioles. Components of cigarette smoke contribute to the…

A: Cancer :- It is a diseases occur in human, in which some of the body cells grow and divide…

Q: C9. The peptide “backbone" consists of repetitive "“units" of amino group nitrogen-alpha…

A: Proteins are biopolymers made of amino acid units. Amino acids are comprised of carbon, hydrogen, a…

Q: evilsgon a en boensd nas odsoulg 4. Approximately 10% of people living in the United States are…

A: Scientific control is a methodology that tests integrity in experiments by isolating variables as…

Q: 11. A part of oxygen system that regulates the delivery of oxygen in liters per minute. a. Oxygen…

A: Note : Hi. Since you have asked many questions. We will answer first three questions. If you want…

Q: The following statements about Firmicutes are false except*

A: Bacteria are prokaryotes. Prokaryotes are unicellular organism. They lack a membrane-bound nucleus…

Q: Lipids Dissolved proleins Polysaccharides. proteins eye) Jayers of tear tluid on the eye. ranswer?

A: Pancreatic juice consists of various enzymes that break down sugars, fats, and starches present in…

Q: Antibodies are one of the key elements in the human immune system. a. What is the general structure…

A: A big Y-shaped protein called an antibody (Ab), sometimes referred to as an immunoglobulin (Ig), is…

Q: Complete Structural Formula Molecular formula (a) C-C=c (b) C-C-C-č-OH c-c- -c-c-NH,

A: Organic compounds are those that consists mostly of carbon, hydrogen and oxygen. Other atoms…

Q: A 75-year-old female who presented with dyspnea, orthopnea, lower extremities swelling and…

A: Note: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts…

Q: d. Total number of CO2 released right after the pyruvate dehydrogenase complex reaction: e. Total…

A: As our standard protocol we will answer only three subparts, Thank You.   Total CO2 released after…

Q: What does the kidney release?

A: The renal system or the excretory system is an organ system of the body that comprises a pair of…

Q: Name: Ch. 7 & 8 Crossword Try to answer as many as you can without your notes. Have Fun! Created…

A: Cell is the basic structural, functional, and biological unit of all known organisms. The cell…

Q: Give the function for the following parts. Operculum Swim bladder Gills Lateral line

A: Fishes are cold blooded animals, typically with backbone, gills and fins. The body of a typical fish…

Q: 6. In which spheres do the following processes take place? You may find they fit into more than one…

A: The earth is subdivided into 4 spheres that are biospheres, hydrospheres, geospheres, and the…

Q: Write the name asap

A: We can say that  The human body consists of two major types of skeletons, one is an axial skeleton…

Animal Diversity

Nematodes are commonly known as roundworms. They are free-living, very tiny organisms. They have an elongated and tubular body. These organisms have a nervous system and are mostly act as parasites to both animals and plants.

Platyhelminthes

Platyhelminthes are also known as "flatworms" because as they are dorsoventrally flattened from head to tail. They are invertebrate, soft-bodied, acoelomate, unsegmented and have bilateral symmetry.