Homework Help is Here – Start Your Trial Now!
Engineering
Computer Science
splice_rna (dna, intron_list) This function should accept a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA into RNA involves translating the DNA to RNA and then performing RNA splicing, where the sequence is chopped into smaller segments called introns and exons. Introns are segments of the gene not used for protein translation, so they should be removed from the sequence. Exons are the remaining segments, which are then transcribed sequentially into a protein string. splice_rna[] should return a protein string that results from transcribing and translating the exons of the given string. [HINT: You should use some of your previous functions. It's similar to the last part of labo3.] Example: Sample input DNA string: "ATGGTCTACATAGCTGACAAACAGCACGTAGCAATCGGTCGAATCTCGAGAGGCATATGGTCACATGATCGGTCGAGCGTGTTTCAAAGTTTGCGCCTAG" Sample intron list:

splice_rna (dna, intron_list) This function should accept a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA into RNA involves translating the DNA to RNA and then performing RNA splicing, where the sequence is chopped into smaller segments called introns and exons. Introns are segments of the gene not used for protein translation, so they should be removed from the sequence. Exons are the remaining segments, which are then transcribed sequentially into a protein string. splice_rna[] should return a protein string that results from transcribing and translating the exons of the given string. [HINT: You should use some of your previous functions. It's similar to the last part of labo3.] Example: Sample input DNA string: "ATGGTCTACATAGCTGACAAACAGCACGTAGCAATCGGTCGAATCTCGAGAGGCATATGGTCACATGATCGGTCGAGCGTGTTTCAAAGTTTGCGCCTAG" Sample intron list:

Database System Concepts
Database System Concepts
7th Edition
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Chapter1: Introduction
Section: Chapter Questions
Problem 1PE
See similar textbooks
icon
Related questions
Question
100%

In Python, I do not know how to define this function or how to create it. What is the program that needs to be created?

### Function: splice_rna(dna, intron_list) This function accepts a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA into RNA involves translating the DNA to RNA and then performing RNA splicing, where the sequence is chopped into smaller segments called introns and exons. Introns are segments of the gene not used for protein translation, so they should be removed from the sequence. Exons are the remaining segments, which are then transcribed sequentially into a protein string. `splice_rna` should return a protein string that results from transcribing and translating the exons of the given string. **Hint:** You should use some of your previous functions. It’s similar to the last part of `lab03`. ### Example: - **Sample input DNA string:** ``` "ATGGTCTACATAGCTGACAAACAGCACGTACGACGAACGTGAATCCTGAGGAGAAGTCTCGACGGCATATGGTCAACATGCGCTACGGCAGGCATTGTTCAAAAGTTTCGGCCTAG" ``` - **Sample intron list:** ``` ["ATCGGTCGAA", "ATCGGTCGACGCTGT"] ``` - **The returned protein string:** ``` "MVYIADKQHVASREAYGHMFKVCA*" ```
Transcribed Image Text:### Function: splice_rna(dna, intron_list) This function accepts a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA into RNA involves translating the DNA to RNA and then performing RNA splicing, where the sequence is chopped into smaller segments called introns and exons. Introns are segments of the gene not used for protein translation, so they should be removed from the sequence. Exons are the remaining segments, which are then transcribed sequentially into a protein string. `splice_rna` should return a protein string that results from transcribing and translating the exons of the given string. **Hint:** You should use some of your previous functions. It’s similar to the last part of `lab03`. ### Example: - **Sample input DNA string:** ``` "ATGGTCTACATAGCTGACAAACAGCACGTACGACGAACGTGAATCCTGAGGAGAAGTCTCGACGGCATATGGTCAACATGCGCTACGGCAGGCATTGTTCAAAAGTTTCGGCCTAG" ``` - **Sample intron list:** ``` ["ATCGGTCGAA", "ATCGGTCGACGCTGT"] ``` - **The returned protein string:** ``` "MVYIADKQHVASREAYGHMFKVCA*" ```
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Problems on Dynamic Programming
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Database System Concepts
Database System Concepts
Computer Science
ISBN:
9780078022159
Author:
Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:
McGraw-Hill Education
Starting Out with Python (4th Edition)
Starting Out with Python (4th Edition)
Computer Science
ISBN:
9780134444321
Author:
Tony Gaddis
Publisher:
PEARSON
Digital Fundamentals (11th Edition)
Digital Fundamentals (11th Edition)
Computer Science
ISBN:
9780132737968
Author:
Thomas L. Floyd
Publisher:
PEARSON
C How to Program (8th Edition)
C How to Program (8th Edition)
Computer Science
ISBN:
9780133976892
Author:
Paul J. Deitel, Harvey Deitel
Publisher:
PEARSON
Database Systems: Design, Implementation, & Manag…
Database Systems: Design, Implementation, & Manag…
Computer Science
ISBN:
9781337627900
Author:
Carlos Coronel, Steven Morris
Publisher:
Cengage Learning
Programmable Logic Controllers
Programmable Logic Controllers
Computer Science
ISBN:
9780073373843
Author:
Frank D. Petruzella
Publisher:
McGraw-Hill Education
SEE MORE TEXTBOOKS