Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as depression. The presence of two or more diagnoses is known as
Q: Which is NOT a question that science can answer: (a) Does taking ginkgo reduce the chance of Alzheim...
A: * Gingko biloba is an extract that is obtained from leaves of the Ginkgo biloba tree. * It is believ...
Q: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne...
A: Permutation infers the maximum number of possible arrangements by given things/ variables that can b...
Q: One of the autosomal loci controlling eye color in fruit flies has two alleles: one for brown eyes a...
A: The fruit fly's color of the eye is further controlled by the autosomal locus. The given fly compris...
Q: female nurses in their forties who don't drink with
A: Vaccine: It is substance which triggers the bodies immune system against a particular disease.
Q: 10n: Frans de Waal found that when they differentially rewarded Capuchin Monkeys for the same task, ...
A: The capuchin monkeys are New World monkeys belonging to the subfamily Cebinae. They are not good pet...
Q: Differentiate vasculogenesis from angiogenesis. Explain why blood vessels degenerate as well as the ...
A: Vasculogenesis is the process of blood vessel formation from endothelial progenitor cells. Angiogene...
Q: Which describe the similarities and differences in the composition of DNA and RNA? a.)In DNA Thymine...
A: 13 -correct option is - b.)In DNA Thymine paired with Adenine (T - A): In RNA Adenine paired with Ur...
Q: Hardosaurs like edmontosaur the front feet do they have name or description how they look? It looks ...
A: The comb-crested hadrosaurid (duck-billed) dinosaur Edmontosaurus regalis is a species of comb-crest...
Q: normal microbiota
A: Microbiota can refer to all the microorganisms found in an environment, including Bacteria, viruses...
Q: 3. The presented sequences are coming from one ancestral sequence. Through RE, the ancestral sequenc...
A: DNA sequencing is a laboratory technique used to determine the exact sequence of bases (A, C, G, and...
Q: Onions leaves have been modified for the purpose of _______ Defense (protection from predators) Sto...
A: ✓The scales of the onion bulb are actually modified leaves that provide protection from water loss(i...
Q: Differentiate vasculogenesis from angiogenesis
A: Vasculogenesis- vasculogenesis is the de Novo synthesis of blood vessel. It leads to the development...
Q: What is label #7? (snail shell looking thing) A. Cochlea B. spiral valve C. Vestibule D. Eustachian ...
A: Ear is one od the sense organ that help us in hearing. There are majorly divided into 3 parts, *out...
Q: Which of the following terms is related to cladistics?
A: Cladistics is a system of biological taxonomy that defines taxa uniquely by shared characteristics n...
Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme ...
A: The restriction site is the site which is a type of specific genetic sequence present on the DNA fra...
Q: Amanda is a 42-year-old female diagnosed with type 2 diabetes. She feels that it was only a matter o...
A: Diabetes is an ailment that happens while the level of glucose in your blood (blood sugar) is simply...
Q: e strongest force that caause plate movement is
A: Thermal convection is a force which is caused by the heat of the interior of the earth. Hot currents...
Q: Explain some of the ways genes may interact to affect the phenotype and discuss how a single gene ca...
A: ANSWER: Some of the ways by which genes may interact to affect the phenotype are mentioned below: ...
Q: The study by Wakefield et al. that purported to show a link between autism and the MMR vaccine was p...
A: Answer- (d) All of the above
Q: O) n an animal cell, under aerobic conditions., what molecule(s) will pyruvate be converted into nex...
A: Pyruvate is formed by glycolysis in cytoplasm. The main function of pyruvate is to serve as the tran...
Q: Is the blood in motion or not in motion after an activity?
A: Our blood is carried to different organs by the arteries continuously. The heart pumps the blood (ox...
Q: Meiosis_______ . a. occurs only in animals b. supports growth and tissue repair in multicelled spec...
A: Meiosis is a cell division that forms four progeny cells from a single parent cell.
Q: TOPIC: The response of an HIV strain to antiviral drugs. Research your specific example of natural s...
A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...
Q: H 1. What type of DNA form (A-form, b-form, Z-form) is represented by the cyan strand in the image? ...
A: Nucleic acids are genetic molecules that transfer and store information in cells at the molecular le...
Q: Plant roots develop differently from plant shoots during primary growth. Explain: How is the forma...
A: Introduction Plants undergo primary growth to increase length. It is result of rapid cell divisi...
Q: How many N-terminus are there in this cartoon?
A: *There are four types of protein structure are present. primary structure secondary structure terti...
Q: A group of closely related strains, not all identical * a. class b. specie c. no...
A: A strain is a genetically different variety, a subtype within a biological species. Nomenclature is ...
Q: Poly-A chain would produce what type of amino acid chain?: Is it Poly-Alanine, Poly-Arginine, Poly-A...
A: Poly A tail is added to the mRNA molecule for enhancing the stability of the molecule during process...
Q: A collection of similar phyla or divisions * a. family b. order c. kingdom d...
A: 1. A collection of similar phyla or divisions- c. Kingdom Kingdom: In biology, a kingdom is the se...
Q: Define linkage and relate it to specific events in meiosis.
A: If two alleles of genes are located close together on the same chromosome, both the genes will be pa...
Q: Match the rodent ovulatory cycle phase with the correct hormone combination Proestrus x Peak Progest...
A: The term menstrual cycle is associated with the occurrence of cyclic ovarian activities in mammals. ...
Q: Coat color of dogs depend upon the action of at least two genes. At one locus a dominant epistatic i...
A: There are some important points: We know that genes are functioning independently on each other and ...
Q: 3. What is the difference between the compound light microscope and the stereo microscope? (1 Point)...
A: Compound microscope A compound microscope is commonly used to view something in deta that we can't ...
Q: Use an example to describe tumor suppressors
A: Cancer is the state of uncontrolled cell division that has some genetic factors.
Q: Procedure A Take 3 ml Add 50 ul of Top up to 50ml. - Add fresh LB Mix Sml ampicillin to the overnigh...
A: We can test the antimicrobial resistance of any strain of bacteria by exposing the bacteria to that ...
Q: dentical a. class b. specie c. nomenclature d. strains 2. A group of morphologically similar organis...
A: 1)Ans- D)strains Explanation- A strain is a defined as group of designated offspring that are eith...
Q: What is transpiration
A: A complex traffic material is moving in different directions in a flowering plant, with each organ r...
Q: How is the concept of norm of reaction related to the lack of yellow hydrangea flowers illustrated i...
A: Hydrangea also know as hortonsia it is a genus of over 75 species of flowering plants in native to A...
Q: Aside from outer pinna, what structures do mammals have in their ears that reptiles and birds do not...
A: * pinna is absent in many mammals and this organ acts as a heat dissipator but not involved in hea...
Q: Why do blood vessels degenerate during organogenesis? What is the significance of this degeneration?
A: In human body blood vessels helps in the delivered of blood to the organs and tissues in our body. ...
Q: Which of the following statements about nutrient challenges faced by organisms is FALSE? Carnivores ...
A: There are various nutrient challenges faced by organisms in their environment.
Q: Show how data from a two-point test cross can be used to distinguish between independent assortment ...
A: Linkage is the tendency for a pair of genes on the same chromosome to be transmitted down to subsequ...
Q: 3. Red-green color blindness (b) is a recessive sex-linked trait. A colorblind male marries a normal...
A: * Red-green color blindness is also called as deuteranopia. * The affected individuals having this t...
Q: Gather data about the mammals, an organism from the animal kingdom, from its classification system, ...
A: Taxonomy is the systematic classification of living organisms into groups or categories based on pre...
Q: VP Indole (+ or -) Organism Gram Cll EMB Catalase MSA Oxidase (+ or -) (+ or -) (growth/ characteris...
A: * The bacteria is divided into two types based on gram staining Gram positive Gram negative. * The...
Q: 2. How should the following patients be identified? a. siblings or twins b. newborns C. common names...
A: Identification is essential in both civil and criminal cases in living persons (cases like divorce, ...
Q: What is sumoylation and how does it affects newly synthesized proteins?
A: SUMOylation :- It is a post translational modification that is involved in various cellular process....
Q: What principle is involved in the isolation of albumin?
A: Albumin is protein that is made by the liver, Albumin helps to Keep fluid in the bloodstream. It car...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
Q: 4. Characterize the following human chromosomes as to size and as to position of its centromere. Typ...
A: Chromosomes are thin structure present inside the nucleus which consists of DNA , proteins and most ...
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which of the following is a social indicator of mental illness? Alcohol use Tobacco use Illicit drug use All of the aboveA nursing student is nervous and concerned about the workshe is about to do at the clinical facility. To allay anxiety andbe successful in her provision of care, it is most important forher to:a. Determine the established goals of the institutionb. Be sure her verbal and nonverbal communication iscongruentc. Engage in self-talk to plan her day and decrease her feard. Speak with her fellow colleagues about how they feelWhich of the disorders are MOST likely to be comorbid with substance use disorder(alcohol, drugs)? cyclothymic disorder panic disorder post traumatic stress disorder social anxiety disorder Bipolar disorder (either I or II) persistent depressive disorder attention deficit disorder adjustment disorder with mixed emotional features double depression
- Get nursing diagnosis that relates to depression for this patient. In the nursing diagnosis include related to and evidenced by. Include short term and long term goal for each diagnosisWhat is the sense of the tragedy of suicide, given that NDE's appear to be real experiences? What do these experiences, which are related to crisis states in certain respectsAn example of Psychosomatic Disease heart break after the death of a long term partner. loss of a pet a disease created from occuptaional stress. All of the above.
- A major depressive disorder can be a debilitating condition which often has significant social and occupational impacts. A consumer’s cultural beliefs may also impact how they experience depression. Critically analyse: • one (1) culturally safe nursing intervention for a consumer with major depression; (you must identify the culture your evidence is referring to); • one (1) evidence-based psychoeducation strategy which can be adopted when working with someone who has a depressive illness.Frank, age 28, is engaged in ongoing supportive therapy through the outpatient clinic. He was diagnosed with a personality disorder when he was 20 years old. His history is significant for limited and unstable relationships with others. He is estranged from his family after they endured years of his manipulative behavior. Frank’s sister describes it in these words: “He will pull us in tightly by some urgent emergency—usually a suicide attempt—and then abruptly push us all away telling us we don’t understand him and never care enough to try to help. We just can’t go through this anymore. My parents have had enough. It’s ruined their marriage.” His assessment shows that his mood and affect are labile and volatile. He is impulsive, having attempted suicide on seven different occasions over the past 2 years. Frank reports frequently engaging in unsafe behavior with prostitutes, and he has several homemade tattoos on his arms, back, and neck. (Learning Objective: 1, 3, and 4) a. The…Get/ list all the nursing diagnosis that relates to depression for this patient. In the nursing diagnosis include related to and evidenced by. Include short term and long term goal for each diagnosis
- Neglect a patient right who don't speak and disabled who can not move. describe a perspective that should be considered related to this event (how they might feel: e.g. client, peer, family, another discipline, etc.).Which sentence accurately describes the International Classification of Diseases (ICD) O It focuses on the dysfunction of the individual. O It is the most superficial of the five models. O It provides the cause (if identified) of some mental disorders. O None of the aboveDefine antisocial personality disorder and the symptoms that we may see from an early age and discuss what kind of preventative measures we could take at the family and social level. Think about not only reactive approaches but also proactive (e.g., training for parenthood, the impact of TV and movies, drug culture, unemployment, etc.). Find articles that validate your point. Make sure to incorporate your thoughts about how culture may influence the diagnosis of personality disorders.