ree with) un-selected.) diploid cell from a human being with one chromosome missing a romosome extra, yet still 46 chromosomes in total. offspring that inherited in three or more complete of the genon rents of the same species. amete from a human female that contains one complete set c Itwo X chromosomes. offspring that inherited one complete set of the genome from erent species.

Q: Relate the importance of Human genetics as science.

A: Study of inheritance and genetic material is known as genetics. father of genetics : Gregor Johann…

Q: 50 words essay on how important to have an adequate knowledge of biochemistry in understanding…

A: The branch of science that deals with the chemical substances and the processes involving them, that…

Q: xplain the reason that genetics is crucial to modern biology.

A: Understanding genetics is crucial because it demonstrates one of biology's fundamental principles:…

Q: Explain The Study of Human Genetics Is an Ongoing Venture?

A: Genetics is the branch of biology that deals with the study of genome of an organism and its gene…

Q: DNA contains the hereditary code for:   A. Carbohydrate structures in the body B. protein…

A: DNA - genetic material/hereditary material. It is passed from parents to progeny.

Q: How has DNA technology advanced the reconstruction of one-living and currently-living organisms? B.…

A: We have known that an organism's DNA affects how it looks, how it behaves, and its physiology. So a…

Q: Autism The genetic basis: what gene or genes are involve  A description of the scientific methods…

A: Autism is defined as an innate inability to create normal, biologically determined, emotional…

Q: Which of the following statements accurately describes genetic mutations? *       Mutations are a…

A: Mutation - A alteration in the DNA sequence of an organism is referred to as a mutation. Errors in…

Q: What are the application of human genome(not human genome project) into health, biochemistry, and…

A: Human genome comprises of human's nucleic acid sequences that are encoded only in form of DNA. This…

Q: explain some of the ways in which genetics is important to all of us.

A: Genetics is the branch of Biology dealing with the study of genes including their structure,…

Q: why dna is not destiny?

A: DNA is a double helix formed by base pairs attached to a sugar-phosphate backbone. It is hereditary…

Q: Define clinical genetics?

A: Introduction: Genetics is a branch of biology that deals with the understanding of genes, variation…

Q: Which of the following is NOT true about the agouti gene? -methylated gene results in a brown coat…

A: The answer is the gene can be methylated and unmethylated during an individual's life because it…

Q: Genetics of Neurological/Neuromuscular Disorders The genetic basis: what gene or genes are involved…

A: Neuromuscular disorders include many disorders that affect motor and sensory nerves that is…

Q: Explain how are genetics and evolution related.

A: Genetics is the study of gene expression within cells, which results in the formation of genotypic…

Q: How One Gene May Contribute to Several Characteristics?

A: Chromosomes are the carrier of genetic material deoxyribonucleic acid (DNA). They are coiled in…

Q: Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: How does knowledge of genetics helps to improve our lives?

A:

Q: Which of the following best describes the relationship between DNA, genes, and chromosomes? a-…

A: To know how features are passed down from parents to children requires incorporating knowledge of…

Q: Which of the following statements about mutations are true? * Mutations are always passed down to…

A: Mutations are alterations that occur in the DNA sequences that are caused by mutagens. Mutagens may…

Q: Every single cell in your body contains the same genetic information. Determining right and wrong

A: Every cell contributes to the organism's overall functioning. Cells are designed to execute certain…

Q: Is DNA information considered to be Big Data?

A: Deoxyribonucleic acid or DNA is a nucleic acid that contains the genetic information for the…

Q: about the human genome? (Select ALL that are true) The human genome contains 23 pairs of…

A: Genome may be defined as the complete set of chromosomes in any individual.

Q: Need help to understand about the Central Dogma, with questions below.  The Central Dogma What is…

A: DNA is the basic unit of inheritance. The genetic material carries information that are in form of…

Q: Define the words “gene” and “chromosome” so that a person without a science background will…

A: A gene is defined as a component of deoxyribonucleic acid (DNA) that promotes the transmission of…

Q: What choice best descirbes how genes are used in different cell types in your body. An example of…

A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…

Q: apply the knowledge of the molecular structure and function of DNA, RNA and proteins to understand…

A: "JJ has a novel therapy for Sickle Cell Disease called Voxelotor (Oxbryta)". By enhancing…

Q: DNA Phenotyping is the process of:   Question 12 options:   Inferring an individual's genotype…

A: DNA Phenotyping is the process of predicting an individual's physical traits or characteristics…

Q: Genetic is the study of?

A: Genetics is a branch of biology which deals with the study of genes and their importance in…

Q: Are you in favor of Genetic Engineering? Yes or No? Why?

A: genetic engineering has been used for the mass production of of insulin, human growth hormones,…

Q: Using Mendel's law to make a more beneficial animal or crop is an example of ? Biotechnology O DNA…

A: Mendel’s law : Mendel worked on pea plants and gave fundamental laws of inheritance. He gave…

Q: 23 Which of the following statements about mutations are true?

A: The mutation is defined as a sudden, inheritable change in a DNA sequence. The process includes the…

Q: Genomes are     the shared genetic information among all living cells on Earth.     the sum of…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: Explain how mutation causes variation

A: Mutation- simpler definition for mutation is The Change in our DNA pair sequence due to various…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.