Question: We have an array of 20 integer elements which is supposed to contain the values from 1 to 20. User may not input all the number and skip a few, duplicating the same number for many times. For examples user misses 9 and enters 2 in place of 9, so 2 is entered twice in the array. Your task is to determine the missing values in the array of 20 elements and display all those values on console. For example; in array of 10 elements, A={2,3,5,7,8,4,1,5,5,2) Missing elements are: 6,9,10

Question: We have an array of 20 integer elements which is supposed to contain the values from 1 to 20. User may not input all the number and skip a few, duplicating the same number for many times. For examples user misses 9 and enters 2 in place of 9, so 2 is entered twice in the array. Your task is to determine the missing values in the array of 20 elements and display all those values on console. For example; in array of 10 elements, A={2,3,5,7,8,4,1,5,5,2) Missing elements are: 6,9,10

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

calcAverage function: This is function that returns no value and accept no parameters. This function will do the following: Ask the user to enter how many integers to enter. This has to be a positive integer and you need to validate that Write a “for” loop to accept this many integers and write the needed logic to calculate the average of these numbers and print that out Then the function will return back to the main function
When do you want to use these loops in java A) a for loop B) a while loop C) a do loop
c++programming language
C#(Sharp): I made my code and design below. Anybody can help me some correction and add some design button and code. "Need to make C# step by step design and code "Calculator where make a calculator program that can do add, subtract, multiply, divide and square root. It should have a memory save/restore function for one number. There should be a way to set the number of fraction digits displayed". Code: using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Threading.Tasks; using System.Windows.Forms; namespace AktCalc { public partial class Form1 : Form { string last = ""; bool minus = false; bool plus = false; bool divide = false; bool multiply = false; string memory = ""; public Form1() { InitializeComponent(); } private void button2_Click(object sender, EventArgs e) { if (textBox1.Text.Contains(",")) { return; } else { textBox1.Text += ","; } } private void…
Q2: a- Write a program to pass two integer numbers as parameters to a function; this function is used to calculate and return the result of multiplication and division of the two numbers.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Drawa structured flowchart , C++, write pseudocode that describes the process of guessing a number between 1 and 100. After each guess, the player is told that the guess is too high or too low. The process continues until the player guesses the correct number. Pick a number and have a fellow student try to guess it following your instructions.
how does a programmer decide to use while loop versus a for loop?
1) Rolling dice simulator in C language Requirement: . Write a program that stimulate rolling dice. When the program runs it will randomly choose a number between 1 and 6 . . The program will print what the number is . It should then ask you if you'd like to roll again . Do it C , and also use while loop
You want to execute a block of code only if age equals 65.