Question 7. A channel that opens in response to the binding of a specific molecule, which is usually not the solute that passes through the channel is called a A. voltage-gated channel B. charge-gated channel C. ligand-gated channel D. positive-gated channel E. electric-gated channel

Q: Which of the following levels of protein structure may be affected by hydrogen bonding? (a) primary ...

A: Protein is the biomolecule which comprise the one or more long chain of amino acids which belongs to...

Q: Which of the following does not apply to banding patterns in chromosomes O a. are unique O b. are pr...

A: Chromosomes are structures that contain DNA molecules and are located inside the nucleus. A single c...

Q: d on the given transgenic organism, give a brief explanation on the alterations of the organism

A: A plant, animal, or microorganism whose genetic material changed using technology that generally inv...

Q: The genetic variability among organisms-usually referring to individuals of the same species. 1. The...

A: Introduction Genetics is a branch of biology that studies genes, genetic diversity, and heredity in ...

Q: What is the predominant ionic form of ribose-5-phosphate at physiological pH?

A: The predominant ionic form of ribose-5-phosphate at physiological pH is 5-Phosphoribosyl-1-Pyrophosp...

Q: In the self of a polygenic trihybrid R1/r1 ; R2/r2 ; R3/r3,use the product and sum rules to calculat...

A: When a self cross takes place between the polygenic hybrid, then: The probability in which only one...

Q: Draw a diagram of a nucleotide with a deoxyribose sugar. Number the carbons on the sugar

A: Deoxyribose sugar is a 5 carbon ringed sugar which is the sugar that is found in the DNA. It is said...

Q: 10. You have a blood stain and want to match it to a large number of blood samples. only a minute am...

A: A microscope is a scientific tool that is used to study items which are too small for the naked eye ...

Q: Identify the monomers for the following polymers A.) Maltose B.) Sucrose C.) Lactose

A: INTRODUCTION The monomer of the polymers is given below.

Q: The branch of pharmacology dedicated to studying what happens to substances once they get into a liv...

A: The branch of pharmacology dedicated to studying what happens to substances once they get into a liv...

Q: Albinism is a recessive trait where an individual does not produce the pigment melanin. A man and wo...

A: Albinism is an autosomal recessive mutation caused due to deficiency of tyrosinase enzyme , a copper...

Q: A medium containing an abundance of substrate was seeded with 20 mg/L VSS of an active mixed culture...

A: Detecting specific genes can be used to screen a collection of isolates and obtain the distribution ...

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...

Q: The MAOIS work by inhibiting the reuptake of monoamines.

A:  MAO are Monoamine oxidases. They are a family of enzymes that catalyze the oxidation of monoamines....

Q: The first human cells to be successfully cultured were derived from a malignant tumor. Do you think ...

A: Human body contain numerous cells . Each cell perform their own task . It contain nucleus . Nucleus ...

Q: All the human races like Africans, Asians, European and others might have from common ancestors. Pro...

A:

Q: In tomatoes, red fruit is dominant over yellow, two-loculed fruit is dominant over many-loculed frui...

A: There are different types of crosses that can be observed in nature. One the crosses is monohybrid c...

Q: List and describe the six functions that proteins provide to cells

A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as ca...

Q: Explain the Retrotransposons—the Copia –White-Apricot System in Drosophila ?

A: In Drosophila the w(a) allele differs from the red-eye gene (w+) by the insertion of the retrovirus-...

Q: Define the role of lactose in induction ?

A: Their are wide range of meaning of induction in biology with respective to branches of biology.In em...

Q: Fluid portion of the mitochondrion and also the site of Kreb's cycle. * a, matrix b. stroma С, сytos...

A: INTRODUCTION Answer of question 1-3 is given below.

Q: What happens when you eat? How does a breakfast of scrambled eggs with spinach and multi-grain toast...

A: Introduction:  Nutrients are components in food that an organism uses to survive and grow. They are ...

Q: Define phagocyte

A: Cells are the primary and elemental part of living beings just like atoms for matters. The subcellul...

Q: 4. Identify the particular parts on the microscope and indicate what it would be used for. A C А B В...

A: Answer : the parts of microscope are :  A)  objectives : the objectives are the lens that are there ...

Q: The shape of cucumber may either be long (SLSL), round (SRSR) or oval (SLSR). If long cucumber is cr...

A: A gene is a segment of DNA that codes for a trait. The phenotype of an organism is the collection of...

Q: Consider the following estimates:(a) There are 7 x 109 humans living on this planet.(b) Each individ...

A: Answer - a) There are currently 1.4×109 mutations present in the human population. this is calculate...

Q: 1. Does candida famata yeast from animal meat can cause diseases when person ate that contaminated m...

A: Yeast can be referred to as eukaryotic organism that possesses single cell. It can be categorized in...

Q: A significant number of mutations in the HBB gene that causehuman β thalassemia occur within introns...

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying e...

Q: Which of the following is true of mychrrhizae?   1. The fungal hyphae of ectomycorrhizae form arbu...

A: Given: The symbiotic association of a fungus with the roots of higher plants (gymnosperm and angiosp...

Q: Communities of organisms, together with abiotic entities, make up an ecosystem. What are these "abio...

A: Given: Communitiies of organisms together  with abiotic entities make up an ecosystem.Ecology is the...

Q: In a bacterial culture in which all cells are unable to synthesizeleucine (leu-), a potent mutagen i...

A: A colony-forming unit (CFU) is a unit that is used in microbiology to measure the viable number of b...

Q: 4. Tigers, jellyfish and sponges are all apart of this kingdom: a. animalia b. plantae c. fungi d. b...

A: The Five Kingdom Classification is one of the most widely used methods for classifying living organi...

Q: What reflex occurs when stretch receptors in the stomach are stimulated or blood glucose levels rise...

A: The stomach is one of the most distensible organs in our body. Stomach in its relaxed state could ac...

Q: The primary determinant of automatizatio nlautomaticity is: the material genetic the other tasks req...

A: When an organism is born , it is like a blank page. With time it learns various activities. The proc...

Q: Which lobe of the cerebral cortex is the center for impulse control (the brain's "stop sign")? parie...

A: As the nervous system is one of the most important system present in the body;which are able to main...

Q: 7. The science of classifying all living organisms A series of questions grouped with 2 options wher...

A: The living organism have ability to move and reproduced. They are classified according to their char...

Q: Question 1: Most (but not all) of the important functional groups on biological molecules a. contain...

A: Functional groups are group of atoms that forms parts of molecules and give specific properties to t...

Q: In an experiment focusing on weight gain between ages 3 and 6 weeks in mice, the difference in mean ...

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up ge...

Q: Which step in the lytic cycle follows attachment of the virus and and release of DNA in to the host ...

A: 12) The answer of this question will be option (d). A lytic cycle is the cyclic process in which a v...

Q: Charles Darwin, himself a proponent of pangenesis, publishes On the Origin of Species his explanatio...

A: Though Darwin wasn't sure of the mechanism by which traits were passed on, he did not believe that e...

Q: What are the parts of cell involved during meiotic division? Specify the parts during prophase, meta...

A: Introduction :- A cell must first go through interphase before entering meiosis I. The cell grows du...

Q: Explain in detail, how did Candida famata contaminate or spoiled the snail meat?

A: Candida famata is a fungus that lives in the snail meat, and while its presence doesn't indicate spo...

Q: e-effect curve that is marked by the X is known as:

A: Dose effect curve is defined as the relationship between a given drug dose and its response. In this...

Q: A continuously growing population of alligators has a population size of 1,000 and an intrinsic rate...

A: Introduction :- The term "population" usually refers to the number of people living in a specific lo...

Q: How do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples...

A: According to the question, we have to explain the process by which normal cells get transformed into...

Q: In maize, a Ds or Ac transposon can alter the function of genesat or near the site of transposon ins...

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying e...

Q: Compare DNA transposons and retrotransposons. What propertiesdo they share?

A: A transposable element (TE, transposon, or jumping gene) is a DNA sequence that may move about withi...

Q: Peptidoglycan is composed of: Strands of repeating subunits of G and M with a short stem peptide lin...

A: Given: Bacterial cell wall is made up of Peptidoglycan.Bacterial cell wall provides structure and sh...

Q: Because the brain loses the ability to create new neurons very early in a person's development, neur...

A: The neural cells or the neurons present in the brain can not be replaced once damaged in adulthood a...

Q: A statement that states what the results of an experimental study will be; "what" will occur. Mimics...

A: The terminology plays a significant part in the comprehension of context and particular texts. Under...

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.