Question 5 1 pts The letters A to D represent a mutation in the DNA sequence. Specifically they represent a deletion of 3 nucleotides. Which of the mutations would be considered an allele of the gene? Gene DNA Coding strand 5' Template strand 3' A IB regulatory region Promoter ப D B A B 0 D +1 RNA-coding region 3' 5' Terminator Transcription Start codon Stop codon mRNA 5' 3' 5' UTR 3' UTR Polypeptide H₂N- Amino terminal (N-terminus) Translation COOH Carboxyl terminal (C-terminus)

Q: In trans splicing O two introns from different transcripts are brought together two exons from the…

A: Answer: SPLICING = It is the cutting or removal of introns from the mRNA transcript and joins the…

Q: Another name for the RNA polymerase recognition/binding site upstream of a gene is the O a. promoter…

A: Introduction :  In transcription process RNA polymerase binds to the DNA upstream of the gene at a…

Q: Question 41 Promoters for RNA pol I O contain a TATA box contain an upstream control element (UCE)…

A: The transcription is a process in which the RNA molecule is produced from the DNA. The transcription…

Q: What is the difference between an operator and a promoter?

A: Replication is the process by which DNA makes identical copies. Transcription is the formation of…

Q: If you were to observe the activity of acetylated DNA, you would expect it to: O be very actively…

A: As DNA is wrapped around the histone proteins;to form a more compact structure inside the…

Q: 7. If the electrical leads were reversed by mistake (red connected to black), what would be the…

A: Gel electrophoresis is a technique which is used to separate the DNA on ths basis of size, charge…

Q: Introns were discovered O MRNA to DNA O protein to DNA O MRNA to protein none of the above

A: Ans- mRNA to DNA.

Q: QUESTION 13 You have isolated a nonsense mutation caused by a base substitution. This mutation is a…

A: Nonsense mutation: These mutations change a codon in a gene to one of the three termination codons…

Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…

A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…

Q: 17. The genetic code

A: The above given statement is about genetic code.

Q: O a. Chromosomes O b. Multivariate expression O c.Monocistronic mRNA O d. Homeostasis O e.…

A: a. chromosomes are genetic structures present inside nucleus composed of DNA tightly coiled around…

Q: DNA methylation is associated with: OA gene repression. O B. neither gene transcription nor gene…

A: DNA Methylation is one of the processes of histone modifications that falls under the field of…

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: RNA pol II core promoters O are usually about 40-60 bases long O have consensus sequences at -10 and…

A: That sequence which is directly responsible for the initiation of the transcription is called as RNA…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: Which one of these mutations would definitely NOT affect the function of the protein coded by the…

A: Mutation is defined as the event where the gene sequence of the DNA is altered giving rise to…

Q: QUESTION 3 Methyl groups are added to histones by. O A. histone deacetylases B. histone methyl…

A: Histones belong to a family of basic protein which relates with DNA present inside the nucleus  and…

Q: Which of the following DNA regions is NOT involved in gene expression regulation in eukaryotes?…

A: Introduction Gene expression is the process through which information from a gene is used to build a…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: Nucleic acid are the macromolecule which carries genetic instructions . Instructions vare passed on…

Q: Teminator Promoter Gene (DNA) AUG UA Exon 1 Exon 2 Exon 3 Exon 4 Intron 1 Intron 3 14 Intron 2 15 15…

A: To initiate transcription, RNA polymerase binds to the promoter, so the promoter helps in…

Q: UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence…

A: Intrinsic terminators, often referred to as rho-independent terminators, are sequence patterns…

Q: RNaseP O processes the 5' end of tRNAS contains an RNA component O both a and b O none of the above

A: A ribonuclease is an enzyme that cleaves ribonucleic acid (RNA). RNA is a single stranded structure…

Q: Mutations - Create a nonsense point mutation in this coding region of the gene. Make sure to…

A:

Q: Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Question 35 Promoters for RNA pol II O are often located downstream of the start site of…

A: RNA polymerase III is located in nucleus. In eukaryote cells, RNA polymerase III transcribes DNA to…

Q: CRISPR in nature evolved as a "bacterial immune system" or "genetic vaccine" to target infecting…

A: CRISPR stands for "Clusters of Regularly Interspaced Short Palindromic Repeats". Cas9 is the…

Q: QUESTION 3 Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is…

A: Transcription: The process of transcribing a piece of DNA into RNA is known as transcription.…

Q: The tri snRNP particle O contains the snRNPs U4,U5 and U6 comes after the binding of U2 O brings the…

A: In splicing apparatus, there are involved  short RNA molecules associate with the proteins to form…

Q: In all types of splicing O a 2' OH form an A in the branch point attacks the 5' splice site O the…

A: IN all types of Splicing