Question 1 Origin 5' 3' 3 5' Unwinding Unwinding Origin Question 1: The following diagram (below) represents the template strands of a replication bubble in a DNA molecule. Draw in the newly synthesized strands and label the leading and lagging strands.
Q: QUESTION 6: What would the PCR product be for the following DNA sequence at the end of one cycle of…
A: Polymerase chain reaction ( PCR) *Polymerase chain reaction is a technique which will make…
Q: Question: DNA molecules are compressed by integrating with non-nucleic acids. What property of these…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms. It is present in the…
Q: Question 35 This enzyme is responsible to cleave the sugar–base bond to delete the modified…
A: Enzymes are special protein molecules used to catalyse a biochemical process in the body. In…
Q: Question 1. Why is DNA replication called semiconservative?
A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.
Q: 2. 3. Original - (template) DNA Adenine Thymine Cytosine Guanine 7._ Original (template) DNA strand
A: DNA replication is the process which produces daughter dsDNA from the parental dsDNA. It takes place…
Q: Question 33 Following is the DNA repair mechanism for double stranded DNA damage:…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Which event in prokaryotes is most like the segregation of sister chromatids in eukaryotic mitosis?…
A: Cell division is a natural process in which a parent cell divides into two daughter cells. Cell…
Q: The orginal strand is 5' G-A-C-C-A-T 3' Question: What is the new replicated DNA strand? The…
A: In atomic science, DNA replication is the natural procedure of creating two indistinguishable copies…
Q: Refer to the image and answer the questions. 1. Which among the two strands will have a continuous…
A: A replication fork is formed when double-stranded DNA molecules are separated into single strands…
Q: Question 1 DNA replication is said to be semi-conservative because Question 1 options: each…
A:
Q: Question 1 What gives the DNA molecule a negative charge? (A deoxyribose (B) ribose c phosphate…
A: DNA or deoxyribonucleic acid is genetic material in living organisms that are responsible for…
Q: Question 14 Which of the following is NOT true regarding E. coli replication on the lagging strand?…
A: In case of E. Coli replication of lagging strand: The synthesis is discontinuous and occurs 5' to 3'…
Q: QUESTION 23 Which of the following is true for DNA replication but not RNA transcription? O It…
A: Gene flow occurs through DNA to RNA to proteins. This is central dogma involving processes like…
Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…
A: During DNA duplication, is the method to copy DNA stands when new cells are formed.
Q: Question 4 A plasmid is (A) a virus that infects bacteria an artificially created cytoplasm C) a…
A: -A virus that infects bacteria is known as bacteriophage or phage. The viruses simply invade into…
Q: Question 30 The 3’ end of a DNA molecule has a phosphate group hanging off. True False…
A: DNA is the genetic material. It is double stranded in nature. It is responsible for regulating all…
Q: Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose…
A: Introduction Translation is the process through which a cell uses the genetic information relayed in…
Q: Question 6 Compare and contrast DNA and RNA in terms of structure and function. Answers will vary…
A: Both DNA and DNA are the genetic material. DNA : deoxyribonucleic acid RNA: ribonucleic acid
Q: QUESTION 9 which one of these is not required for performing PCR O A template O B. DNA bases O C.…
A:
Q: QUESTION 4 Which of the following DNAs is most likely to contain the recognition sequence for a…
A: DNA (Deoxyribonucleic acid) recognition sequence is a specific linear sequence that is recognized by…
Q: Following is the DNA repair mechanism for double stranded DNA damage: Question 33 options: Base…
A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA…
Q: Answer questions 1-5 using the image below. DNA Strand -5 3 2 A 4
A: DNA stands for de-oxyribonucleic acid. DNA is long polymer of nucleotide that contains two strands.…
Q: QUESTION 2 Which of the following statements about nucleic acid synthesizing enzymes (polymerases)…
A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…
Q: Question 10. Which of the following models best describes how DNA is replicated? A. Conservative B.…
A: Introduction :- The process of replicating a double-stranded DNA molecule into two identical DNA…
Q: The following diagram represents the template strands of a replication bubble in a DNA molecule.…
A: DNA replication is a process in which two DNA molecules are synthesized from a single DNA molecule.…
Q: QUESTION 37 A bacterium, containing one circular DNA chromosome, undergoes four rounds of…
A: 37.DNA replication is a essential process in which new copies of DNA are made or duplication of DNA…
Q: QUESTION 5 Observe this replication fork. The lagging strand is the O Top O Bottom Click Save and…
A: Answer - BOTTOM.
Q: Question 4. Why is a single-stranded, circular DNA an ineffective template for DNA polymerase?
A: Introduction Single-stranded DNA is a DNA molecule that has only one nucleotide strand while…
Q: QUESTION 6 Which of the following is the correct term for the fact that DNA bends around and forms a…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Table 1: Characteristics of DNA Questions To what maior group of biomolecules does DNA belong? wers…
A: INTRODUCTION DNA Deoxyribonucleic acid is the heriditary material present in humans and other…
Q: QUESTION 1 Write the order of nucleotides in mRNA that would be transcribed from the following…
A: Transcription is the process by which mRNA is synthesized from a DNA template. During transcription,…
Q: Question 3. How is the primer different in eukaryotic DNA replication than prokaryotic DNA…
A: Primer is a small sized single stranded monomeric nucleotide needed by all living creatures to start…
Q: Question 3 son and Stahl on DNA replication, if the cells are cultured for many generations in a…
A: Introduction: DNA is a genetic material for all living organisms, except some viruses.
Q: responte Question 29 Multipie Answer Question: Erwin Chargaff's rules state that in a typical…
A: Chargaff has stated the rule for the base pairing of DNA in a double-stranded structure. The first…
Q: OPEN ENDED QUESTION List the steps of DNA replication in order. Explain what is happening at each…
A: DNA is the genetic substance that gives each cell its identity. Biomolecules and organelles must be…
Q: Question 3 Based on the animation. DNA is a right handed double helix. O True O False
A: Deoxyribonucleic acid is a molecule consist of nucleotide in which contain sugar, phosphate group…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 3.…
A: DNA is composed of two polynucleotide strands which wrapped around each other like helix- like…
Q: Question 2. What does DNA polymerase need in order to make contact with a replication origin?
A: DNA polymerase an enzyme that can synthesize a new DNA strand on a DNA template is called a DNA…
Q: What would happen to the replication process if the growing DNA chain did not have a free 3' end?
A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…
Q: Question 1 Review DNA sequencing, which method uses a dideoxy chain termination? O Next-generation…
A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors utilised in the Sanger technique…
Q: Question 3 If the fragments of DNA shown below were to replicate with the origin of replication at…
A: Introduction DNA is a self replicating molecule. DNA replication is a process by which one DNA…
Q: Partial Question 6 Which of the following are true about replisome components at the replication…
A: During DNA replication, the replication fork is a structure that arises within the long helical DNA.…
Q: The diagram below shows a DNA replication bubble. The circles indicate the origin of replication.…
A: Replication is the process of synthesis of new strand DNA from their parent strand. whereas…
Q: How does DNA replicate itself? Your explanation (in essay form) should include the following terms:…
A: DNA replication is a complex process where DNA makes copies of itself using a set of proteins,…
Q: These are enzymes that untwist the double helix at the replication forks of replicating DNA.…
A: DNA replication is the biological process of producing two identical replicas of DNA from one…
Q: Regular DNA replication Question 3 options: Occurs through the addition of nucleotides to the end of…
A: dna replication is the process by which new dna molecules are produced from parent dna molecule .
Q: 384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Which of the following statements regarding ionizing radiation is FALSE? Question options:…
A: Electromagnetic waves are waves with both particle and wave nature. They are produced by vibrations…
Q: QUESTION 1 Look at the image of the the dinucleotide (two nucleotides joined togethr in a single…
A: DNA is a right-handed, helically coiled, double helix structure and the two strands are antiparallel…
Q: which is the leading strand and which is the lagging strand? *27. What would be the effect on DNA…
A: If mutation occurs in DNA polymerase I, the cell will be able to replicate the bulk of replicated…
Step by step
Solved in 2 steps with 1 images
- Question 6 Match term and its description. heat briefly separate DNA strands [ Choose ] cool to allow primers to form hydrogen bonds with ends of | Choose sequence. DNA polymerase adds nucleotides to the 3' of each primer [ Choose )QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.Question 3. How is the primer different in eukaryotic DNA replication than prokaryotic DNA replication?
- Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing method. You then separate the products of the reactions by gel electrophoresis and obtain the following pattern. What is the sequence of the template and the DNA on the gel? ddATP ddTTP ddCTP ddGTP Template V [ Choose 3'-CTAGTCAAGG-5' 5'-CTAGTCAAGG-3' Sequence 3'-GATCAGTTCC-5' 5'-GATCAGTTCC-3' 5'-GGAACTGATC-3'QUESTION 20 Careful TEM studies suggested that histone octamers get removed during DNA replication. This raised a question regarding what happens to the histone octamers after they get removed. Do the histone octamers get disassembled after removal, or do they remain intact and get added back onto the DNA without disassembly. The figure below outlines an experiment that researchers performed to address this question. In a single sentence, describe the conclusion that can be drawn from this experiment. Experiment Question: What happens to histones in eukaryotic DNA replication? Methods 1 Grow cells for several generations in a medium that contains amino acids labeled with a heavy isotope. 2 Transfer the cells to a medium that contains amino acids labeled with a light isotope. Results Change medium Replication Isolate octamers 3 Isolate histone octamers before and after replication... Spin 4 ...and subject them to density-L gradient centrifugation. 5 Newly synthesized octamers are less…QUESTION 6 These correct “overwinding” ahead of the replication forks by breaking, swiveling, and rejoining DNA strands. Helicases Single-strand binding proteins Topoisomerase Telomerase
- QUESTION 9 These are enzymes that untwist the double helix at the replication forks of replicating DNA. Helicases Stingle-strand binding proteins Topoisomerase TelomeraseQUESTION 1 For the DNA structure below write the correct base sequence in the form: 5'-ATCT-3' 3'-TAGA-5' Make sure you include the 5' and 3' to indicate strand polarity as shown above. Hydrogen bondQuestion 2. For your senior research, you end up studying the life cycle of an animal virus whose genome consists of a single circular, double-stranded DNA molecule. Your project is to define the number and location of the origin(s) of replication and to determine whether replication proceeds in one (unidirectional) or both (bidirectional) directions away from an origin. To accomplish this, you isolate many identical strands of DNA that have already been partially replicated. You cleave each piece of DNA exactly once with a restriction enzyme. You then observe the cut pieces of DNA using an electron microscope. Below is a schematic representation of what you observe. Remember that each line represents a different piece of DNA, and not a fragment of a larger piece. Using this data, answer the following questions: A) How many origins of replication do you think the viral genome has, and why do you think this? 30: F2 #3 *** E D 80 F3 54 $ 4 F4 R LL % 5 F5 T G B) Do your data support…
- Question 6 1 pts You are assembling the genome sequence of a newly discovered bacterium by aligning a set of BAC clones. Correct assembly requires O spacer regions O repeated sequences O overlapping sequencesQuestion 4 About endonucleases: A Restriction endonucleases always cut double-stranded DNA and are endo- deoxyribonucleases. B Once the DNA sequence is recognized, they cleave the bond between the desoxyri- bose and the nitrogenous base. |C| they are proteins that are necessary for the replication of DNA. they act on single-stranded DNAS, RNAS, and double-stranded DNAS. E they are enzymes whose substrate is a double-stranded sequence of nucleic acids, DNA or RNA, or hybrid DNA-RNA.QUESTION 5 If you ran the amplicon from the previous question (so it's about 3.7k basepairs long), on a gel, what would you want your gel to look like after you stain it with ethidium bromide and look at it under UV, assuming you ran it next to a 1kb DNA ladder? O A. A lot of lighter bands below the 4kb band O B. A very bright band at the bottom of the gel, and a lighter band in the middle of the gel. O C.A bright smear O D. one bright band that lines up between the 3kb and 4kb ladder band. Should be above the 3kb band (closer to the wells). O E. one bright band that lines up below the 3kb ladder band (further from the wells)