Quer:- Motoe lend plate diffee fom nemow to neuwon synape by all the follownig except:- a) Seconday Gynaptie eleft. myelinatid Vesisles in teminal button b) Teeminal button ůs ☺ Presence q tAynaptic (d) the neuroteane mitte is acetyl choline .

Q: Define autonomic nervous system (ANS)

A: The nervous system is the central processing unit of the body. It enables us to perceive and respond…

Q: A patient is found to have a neurodegenerative condition that is autoimmune in nature. The immune…

A: Acetylcholine is a neurotransmitter present at the neuromuscular junction of the autonomic ganglia.…

Q: The junctions between one neuron and another neuron are called dendrite Oon O myelin sheath 3 oel…

A: Neurons/nerve cells are the structural and functional unit of the nervous system. A neuron consists…

Q: Name two cell functions regulated by DAG and IP3

A: The majority of chemicals that cause cell signalling are those that attach to a particular protein…

Q: So named beacause it acts under conscious control?

A: Conscious control means which is under the will or the control of the individual.

Q: What are the mainproteins that constitute thesarcomere? What is thefunction of those molecules inthe…

A: Muscle cells are specific for contraction. It allows for motions and facilitates bodily processes…

Q: What component of a reticular fibre makes it PAS-positive

A: Reticular fiber , it is special subtype of connective tissue that is indistinguishable during…

Q: What are all the parts of the purkinje fibers seen on the image (microscopic)

A: Perkinje fiber  Perkinje fibers are the fibera which conduct electrical impulses and propagate it to…

Q: What ion triggers synaptic vesicles to release neurotransmitters into the synaptic cleft? magnesium…

A: Neurotransmitters are the body's chemical messengers. The nervous system makes use of these…

Q: A neuromuscular syndrome that is an autoimmune disorder (found in patients with certain types of…

A: The neurons are the impulse generating and conducting cells in the nervous system that are present…

Q: Heating is an effective mechanism for killing bacteria on surgicalinstruments. How does elevated…

A: Sterilization in biology refers to the process of killing/removing the microorganisms like bacteria,…

Q: ny does this ion contribute the most to the resting membrane potential (Vmrest) Because this ion…

A: The difference in the number of positively charged potassium ions (K+) inside and outside the cell…

Q: A pivotal role of the autonomous nerve system has been indicated in the pathogenesis of autoimmune…

A: Autonomic nervous system It is a part of the peripheral nervous system that is involved in the…

Q: systent is theough metaphors Check components ot The nervous system by mattch the metuphorical…

A: Neurons use electrical impulses and chemical signals to transmit information between different areas…

Q: functional barrier that prevents passage of antibiotics, and toxins from the blood to nervous 10.…

A: The nervous system controls and coordinates all the activities of the human body. It is classified…

Q: Which Cells insulate axıns with Myctin in the Cuts.?

A: The nervous system controls our body movements, our response to outer stimuli, etc. It is a highly…

Q: Name the six types of cells that aid neurons, and state their respective functions.

A: Neurons are the primary cell type in the nervous system, and they are responsible for transmitting…

Q: The highly branched structures of neurons wouldseem to make it almost inevitable that they should…

A: The central nervous system controls the whole body by communicating with each part, and this…

Q: of Henle, Explain how this drig.couses inoreased unine procdluction.

A: Diuretics are medicines used to increase the quantity of water and salt expelled out of the body as…

Q: What two factors will cause changes in ADH secretionrates? Name the types of sensory cells that…

A: The Pituitary Gland also known as master gland has two separate lobes i.e. anterior lobe(an…

Q: Describe the various division of human Nervous system. Draw and describe the various parts of a…

A: The nervous system is the part of physiology that controls and coordinates all body movements i.e…

Q: Chapter 13, Level 2: Which of the following is true of a muscle spindle? O it is a region where…

A: Introduction: The skeletal muscle fibers are composed of several long and thin cells referred to as…

Q: Explain what the exocytosis of the neurotransmitter does.

A: Exocytosis is the process by which a cell transports proteins or neurotransmitters out of the cell.…

Q: In the intact salivary gland, the major stimulus for secretion is input from the para sympathic (PS)…

A: The cellular response to a particular extracellular signal molecule depends on its binding to a…

Q: Parkinson’s disease is a devastating, progressive disorder ofthe central nervous system. Damage to…

A: The response that our body gives to any external stimuli is due to the transfer of impulse from the…

Q: how the sequential opening and closing of voltage-gated sodium and potassium channels leads to…

A: Answer: sequential opening and closing of voltage gated sodium potassium channels leads to…

Q: Complete the hierarchy of the parts and divisions of the nervous system

A: The nervous system is a vital system within an animal's body that coordinates signals to make proper…

Q: The three types of neurons in the nervous system of humans are O synaptic neurons, motor neurons,…

A: Neuron Also known as nerve cell. It is an electrically excitable cell that processes and transmits…

Q: 3 2 4 5 KKK

A: The Figure 39.1 represents the sliding filament theory of skeletal muscle, which explains the…

Q: Distinguish between acetylcholine, an acetylcholine receptor, and acetylcholinesterase. State where…

A: In synaptic communication, neurons use neurotransmitters to interact with each other and their…

Q: A loss-of-function mutation in the ion channel responsible for the generation of end-plate…

A: Please follow step 2 for detailed expalanation.

Q: haw the physical in our innate (esponse Works barrier (detail, Stinexc)

A: Innate immunity also called as natural or native immunity, consist of mechanism that exist before…

Q: During extreme dehydration, plasma K* can increase to as high as 10 mM. (A) What would the membrane…

A: Introduction  When you use or lose more fluid than you consume, your body becomes dehydrated because…

Q: A Na+ 10 msec B 40mV Ca²+ C Na+ Ca²+ Each graph represents the depolarization activity during an…

A: Introduction: An action potential is a brief electrical signal that travels along the membrane of a…

Q: Based on the direction they transmit actionpotentials, what are the two subcategories ofthe PNS?

A: The human body comprises numerous organs that in certain combinations, make up organ systems.…

Q: Somatic motor neurons: 1) carry sensory signals to the CNS 2) stimulate cardiac muscle 3) are…

A: The motor neurons carry information from the brain or spinal cord and is involved in regulating…

Q: How do Conduction t Rode Of Ranvier relate? Myclin, action potentials, Saltary

A: The structural and functional units of The nervous system which are capable of sending and receiving…

Q: Choose the secondinary messenger НО HO H3C. afafafa ОН ОН OH ОН ОН ОН NH₂ H₂N ОН ОН

A: A hormone receptor is a receptor molecule that binds to a specific hormone and elicits a cellular…

Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…

A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…

Q: The part of the neuron that is usually a single lorg extension that conducts an impulse to a muscle…

A: Neuron is the nerve impulse producing and transmitting cells in the nervous system. They have the…

Eating behaviors

The term "eating behaviors" is an umbrella term that encompasses aspects such as food selection and motivations, feeding habits, dieting, and eating behavior-related concerns such as obesity and eating disorders. Eating behavior is influenced by various psychological, sociological, cultural, environmental, and economic elements.