Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9 (highlighted in red cytosine) on the gene's segment above. Now determine the resulting protein sequences of the new mutant gene's segment. e) Explain the effect of this mutation on the function of the protein. What is the type of this mutation? Relate to symptoms of CF disease (see the above symptoms). THE GENETIC CODE Second letter A UCU UAU ) Tyr UAC UGU Cys UU Phe UUC UCC UGC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUA UCA Leu UUG UCG CUU CCU CAU CGU CAC CAA His CUC CC CGC Leu Pro CCA CCG Arg CUA CGA CUG Gin CAG CGG ACU ACC AUU AAU AGU Ser AUC lle AAC Asn AGC Thr A AUA ACA AAA Lys AGG AGA AUG Met ACG AAG Arg GGU Asp GUU GCU GAU GUC Val GCC GAC GGC Ala Gly GAA Glu GUA GCA GGA GUG GCG GAG GGG Third letter DCAG POAG コ0てO First letter
Anatomy and Physiology of Special Sensory Organs
Sensory organs can be labeled as special sensory structures that permit sight, hearing, odor, and flavor. Sensory structures permitting proprioception, touch, thermal, and pain perception can be classified as more advanced sensory organs. The sensory neurons are trained to find out modifications in the external and internal conditions so that a person's body can react to that change. A stimulus is the first signal that is recognized by any sensory receptor of the body. Stimulus is an impulse generated when there is a change in the surroundings of a person. For example, a heated environment will alert the brain through the thermal sensory organs and generate a reflex accordingly.
Sensory Receptors
The human sensory system is one of the most complex and highly evolved structures, which processes a myriad of incoming messages. This well-coordinated system helps an organism or individual to respond to external stimuli, appropriately. The sensory receptors are an important part of the sensory system. These receptors are specialized epidermal cells that respond to external environmental stimuli. These receptors consist of structural and support cells that form the peripheral unit of the receptor and the neural dendrites which receive and detect the external stimuli.
please only answer part d and e
Trending now
This is a popular solution!
Step by step
Solved in 4 steps