Q1: Nrite a C+ program to create a header have a function that multiply two nunbers. Then call the funet ion in the main code to multiply the following nunbers and display the results on the screen: a) 5, 3 b) 7, 2

Q1: Nrite a C+ program to create a header have a function that multiply two nunbers. Then call the funet ion in the main code to multiply the following nunbers and display the results on the screen: a) 5, 3 b) 7, 2

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: In which of the following cases would it make the most sense to use a b-tree index? SELECT…

A: A database management system (or DBMS). It is essentially just a computer-based data storage system.…

Q: Q1: Write a C++ program to create a header have a function that add two numbers. Then call the…

A: #include <iostream> #include <conio.h> using namespace std; int main() {…

Q: Sam is known for his analytical skills and if the number sequences are good if each element of this…

A: Algorithm: Firstly take input for number of test case Then take the input for the number of values…

Q: Section 2: Program Design 2 Write a C++ program that calculate the area of a circle. • Circle area's…

A: Language is one of the most widely used programming language which has been used to create different…

Q: Q1: Mrite a C++ progran to create a header have a tunction that add two numbers. Then call the…

A: Approach for the program: Firstly create the function name add to addition of the integer Function…

Q: C Programming Problem: In your annual examination you are given two numbers X and Y. Below are some…

A: Here is the code with output:-

Q: Write a program that determines if a number is prime or not. You must define a function that will…

A: Your C++ program is given below as you required with an output.

Q: Problem Statement: Design a program that will determine the winner in the last…

A: #include <bits/stdc++.h>using namespace std; class candidate{ public: string name; int…

Q: 2) Write a general program that takes an integer value from the user. Then generates a Prime…

A: #include<iostream> #include <cmath> using namespace std; // function to calculate and…

Q: C programming:you are to design and write a menu driven program as shown by the sample menu below.…

A: Given, C programming:you are to design and write a menu driven program as shown by the sample menu…

Q: C++ Question Question 3: first position differ Problem statement Given two phrases, write a C++…

A: Define a function named get_position_differ that takes two string arguments and returns the position…

Q: You are required to write a C++ program to do the following: Ask the user to enter the length and…

A: #include<iostream>using namespace std;int main(){ int r,c; cout<<"Enter the length…

Q: PLLLLLLLSSSSSSS Answer Technology College Muscat hired you as a programmer to automate their manual…

A: //Solution: //C++code: //Including necessary header files#include <iostream>using namespace…

Q: 01: Mrite a C++ program to create a header have a tunction that add two numbera, Then call the…

A: /*Program to add two numbers using function*/#include <iostream>using namespace std;…

Q: Programming concept: structures Program should: be a C program, define a structure to store the…

A: A structure named weather has been declared with following data members: year of type int month of…

Q: Q1: Write a C++ program to create a header have a function that multiply two numbers. Then call the…

A: Open notepad and write multiply.h content written below. save it and store it in include folder.…

Q: Q1: Write a C++ program to create a header have a function that add two numbers. Then call the…

A: While doing programming in any programming language, you need to use various variables to store…

Question

li,
M 1:YO
Mid2_A3.pdf →
Q1: Nrite a C++ progran to create a header have a function that multiply two
nunbers. Then call the function in the main code to multiply the following
nunbers and display the results on the scrcen:
a) 5, 3
b) 7, 2
Q2: What is the output for the following codes:
1-
a) 8 25 1
c) 8 25
b) 152
di 1528
int arr[4]= (1, 5, 2, 8}:
for (int i 3; i>-0; i--)
cout<<arrli] <<" ";
2-
a) 48 3
c) 483
b) 4 8
d) 4
int arr[4]= (4, 8, 3, 1};
for (int i- 0; i<2; i++)
cout<<ar[i]<<" *;
3-
a) 36 8 23
c) 6 9 11
b) 368 2
d) 6 9 11 5
int arr[4]= (3, 6, 8, 2):
for (int i- 0; i<4; i++)
cout<<arrfi] +3<<" ":
4-
a) 6 3 27
c) 6 3 2
b) 9 E5
d) 9 65 10
int arr[4]- (9, 6, 5, 10):
for (int i 0; i<3; i++)
cout<<arr[i) -3 <*
5-
int arr[4)= (3, 4, 5, 1}3:
for (int i- 0; i<4; i++)
cout<<arr(i)* 3 << *:
a) 9 12 15
b) 9 12 15 3
c) 3 451
d) 3 45
6-
a) 555
c) 8 8 8
int arr[4]- (9, 5, 8, 2}:
for (int i 0; i<3; i++)
cout<carr[2]<<" :
b) 958
di B B 8 B
7-
int an(4]- (7, 1, 5, 3}:
for (int i- 0; i-2; i++)
cout<arrfi) * arrfi] << " ":
bị 49 1 25 9
a) 49 1
c) 715
d) 49 1 25
II
<>

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3: output

VIEW

Step by step

Solved in 3 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

Module/Week 3 ASSIGNMENT (CONTROL STRUCTURES . IF ..ELSE)Write a C++ program that computes a student’s grade for an assignment as a percentage given the student’s score and total points. The final score must be rounded up to the nearest whole value using the ceil function in the <cmath> header file. You must also display the floating-point result up to 5 decimal places. The input to the program must come from a file containing a single line with the score and total separated by a space. In addition, you must print to the console “Excellent” if the grade is greater than or equal to 90, “Well Done” if the grade is less than 90 and greater than or equal to 80, “Good” if the grade is less than 80 and greater than or equal to 70, “Need Improvement” if the grade is less than 70 and greater than or equal to 60, and “Fail” if the grade is less than 60. Submit C++ Programming Assignment 3 by 11:59 p.m. (ET) on Monday of Module/Week 3.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
C++ LANGUAGE (FUNCTION)
Q1: Write a C++ program to create a header have a function that add two numbers. Then call the function in the main code and use it to add the following numbers and display the results on the screen: a) 3 b) 9 7
Discussion: Files with .h extension are called header files in C. These header files generally contain function declarations which we can be used in main C program, like for e.g. to include stdio.h in C program to use function printf() Exercise 2. Creating myhead.h : Write the below code and then save the file as myhead.h or you can give any name but the extension should be .h indicating it’s a header file. // It is not recommended to put function definitions // in a header file. Ideally there should be only // function declarations. Purpose of this code is // to only demonstrate working of header files. void add(int a, int b) { printf("Added value=%d\n", a + b); } void multiply(int a, int b) { printf("Multiplied value=%d\n", a * b); } Including the .h file in other program : Now as we need to include stdio.h as #include in order to use printf() function. We will also need to include the above header file myhead.h as #include”myhead.h”. The ” ” here are used to instruct…
C programming