Answered: Put the following processes in the…

Name: 10 Put the following processes in the correct order that represents on
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 10 Put the following processes in the correct order that represents one cycle ofpolymerase chain reaction (PCR).extend primersdenature DNAanneal primers<>3.1.2.

Science

Biology

Put the following processes in the correct order that represents one cycle of polymerase chain reaction (PCR).

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Similar questions

1. Please help answer this question and show all work, thank you so much.
1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200
4. Animation 12.4: This table shows results from a genetic test conducted on DNA samples from two patients. The patients are a newly married couple seeking genetic counseling about their risks of passing on a genetic disease to any children they may have in the future. The samples included the DNA region including and immediately surrounding a single gene. Restriction enzyme cleavage analyses were performed on the samples. Female Patient 1) 3400 bp fragment Male Patient 1) 1600 bp fragment 2) 1800 bp fragment 3) 3400 bp fragment DNA fragments on gel What do the genetic test results indicate about this case? O Both the woman and the man are homozygous for the mutation. O Both the woman and the man are heterozygous. O The woman is homozygous for the mutation and the man is homozygous for the normal gene. O The woman is homozygous for the mutation and the man is heterozygous.
Draw one cycle of PCR reaction below the following diagram
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
How many PCR cycles are required to generate double-stranded target fragments?
8.
All are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling introduced by the DnaB protein (helicase). It is a topoisomerase that hydrolyzes ATP during its reaction mechanism. Its mechanism involves the breaking of a single phosphoester bond in one strand of dsDNA. It works to relieve supercoiling in DNA to overcome the torsion stress imposed upon unwinding.
The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme Target sequence |Cleavage 5' GAATTC 3' |3' СТТААG 5' 5'G AATTC 3' EcoRI |3' СТТАА G 5' 5' GATATC 3' |3' СТАТАG 5' 5' GAT ATC 3' |3' СТА ТАG 5' EcoRV 5' GGCC 3' 3' CCGG 5' 5' GG CC 3' |3' СС GG 5' HaellI 5' AAGCTT 3' 3' TTCGAA 5' 5'A 3' TTCGA AGCTT 3' HindIII A 5' 5' RGGWCCY 3' 3' YCCWGGR 5' 5' RG 3' YCCWG GWCCY 3' PpuMI GR 5' Which restriction endonucleases would cleave a DNA molecule at the given sequences? The complementary DNA substrate strand is omitted for clarity. 5' ATCGAACTAGGCC 3' 5' AAAGCTTGTGATATC 3' EcoRI ЕcoRI EcoRV EcoRV HaellI HindIII HindIII HaellI
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
None
Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.