ProblemWrite an assembly program that prompts the user to enter a string of a size that does not exceed20 characters and store it into a data variable wordListA using Irvine library's ReadStringprocedure. The program then displays the string entered by the user in reverse as shown in thesample run below.Sample Run> reverse.exeEnter a string (max 20 characters): wordThe reverse is: drowreverse.exeEnter a string (max 20 characters): BaBThe reverse is: BaB> reverse.exeEnter a string (max 20 characters): sultanThe reverse is: natlus> reverse.exeEnter a string (max 20 characters): abc123The reverse is: 321cba> reverse.exeEnter a string (max 20 characters): &5%1772jsThe reverse is: sj2771%5&Your program must define and use the following procedure:Procedure reverseString: this procedure reverses the string that was read from theuser by copying the characters from the defined data variable wordListA into wordListBstarting from position at length-1 of wordListA and position zero of wordListB inreverse order (NOTE: the last character of a string is the NULL terminator at the last positionsince every string must be terminated with 0 and therefore start copying from length-1). It thencompletes the last position of wordListB by filling it with a NULL terminator (i.e. 0). Forinstance, see the illustration below using the string “ABCD" of length=4:wordListA = “ABCD"position12 3 4character ABCD0wordListB= “DCBA"position14character| D C BA0Grading TablePointsMarkStyle (naming, comments, spacing, indentation)Data Segment with needed variablesMain Procedure (prompt=2, readstring=3, result messages=2, callingprocedure=3)reverseString Procedure (loop=2,indexing=3,handle string nullterminator=3, return from procedure=2)551010Total30Needed Irvine32 Library ProceduresCrlf: advances the cursor to the beginning of the next line in the console window.ReadString: Reads a string from the keyboard.WriteChar: writes a single character to the console window. Pass the character in ALWriteString: writes a null-terminated string to the console window. Pass the string's offset in EDX.

DATA SEGMENT NUM1 DW 12345 NUM2 DW ? ARRY DB 10 DUP (0) TEMP DW ? MSG1 DB 10,13,'STORED NUMBER IN…

Problem Write an assembly program that prompts the user to enter a string of a size that does not exceed 20 characters and store it into a data variable wordListA using Irvine library's ReadString procedure. The program then displays the string entered by the user in reverse as shown in the sample run below. Sample Run > reverse.exe Enter a string (max 20 characters): word The reverse is: drow > reverse.exe Enter a string (max 20 characters): BaB The reverse is: BaB > reverse.exe Enter a string (max 20 characters): sultan The reverse is: natlus > reverse.exe Enter a string (max 20 characters): abc123 The reverse is: 321cba > reverse.exe Enter a string (max 20 characters): &5%1772js The reverse is: sj2771%5&

Problem Write an assembly program that prompts the user to enter a string of a size that does not exceed 20 characters and store it into a data variable wordListA using Irvine library's ReadString procedure. The program then displays the string entered by the user in reverse as shown in the sample run below. Sample Run > reverse.exe Enter a string (max 20 characters): word The reverse is: drow > reverse.exe Enter a string (max 20 characters): BaB The reverse is: BaB > reverse.exe Enter a string (max 20 characters): sultan The reverse is: natlus > reverse.exe Enter a string (max 20 characters): abc123 The reverse is: 321cba > reverse.exe Enter a string (max 20 characters): &5%1772js The reverse is: sj2771%5&

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Pointer Arithmetic Write a program that accepts a string and print the reversed form of that string using a pointer ptr. Input: One line Containing String Sample Output: Enter a string: Test tseT
python: def shakespeare_position(role, section): """ Question 2 - Regex You are reading a Shakespeare play with your friends (as one frequently does) and are given a role. You want to know what line immediately precedes YOUR first line in a given section so that you are ready to go when it is your turn. Return this line as a string, excluding the character's name. Lines will always begin with the character's name followed by a ':' and end in a "." or a "?" Each line is separated by a single space. THIS MUST BE DONE IN ONE LINE. "" Args: role (str) section (str) Returns: str section_1 = 'Benvolio: By my head, here come the Capulets. Mercutio: By my heel, I care not. ' + 'Tybalt: Gentlemen, good den - a word with one of you. Mercutio: And but one word with one of us?' >>> shakespeare_position('Tybalt', section_1) 'By my heel, I care not.' >>> shakespeare_position('Mercutio', section_1) 'By my head, here…
Write a function that parses a decimal number into a binary number as a string. Use the function header:def decimalToBinary(value): Write a test program that prompts the user to enter a decimal integer value and displays the corresponding binary value.
PYTHON PROGRAMMING LANGUAGE Create a new text document called names.txt (this is done by hand - not using programming) with the following names: Adam, Bryan, Charlie. Each name should be followed by a hard return (do not store them in a list). Main Function. Write a program where the user enters a name. Using the read function, check to see if the name is in the text document. If it is, respond back to the user the name is found within the list. Read Function. The read function should return the contents of the text document as a list. Write Function. The write function should take the list and override the file with the new names list in reverse alphabetical order with a hard return after each name. EXAMPLEPlease enter a name: AdamAdam is found in the list.Enter another name (Y/N): YPlease enter a name: AndrewSorry, Andrew was not found in the list. Would you like to add it? (Y/N): YAndrew has been added to the list.Enter another name (Y/N): N LIST EXAMPLEadambryancharlie Final…
Computer Science C++ Convert following program to use a loop and step through input the data for each division , also recive data from an input file that contains 4 row (for each division) and 4 column for each quarter sales //Name://Date://Problem statemnt: Corporate Sales Data Page 659 Gaddis#include#include#includeusing namespace std;// Declaration of the Division structure.struct Division{ string name; // Division name double quarter1; // First quarter sales double quarter2; // Second quarter sales double quarter3; // Third quarter sales double quarter4; // Fourth quarter sales double annualSales; // Annual sales double averageQtrSales; // Average quarterly sales};int main(){ //================= Create structure variables for each division. =================== Division east, west, north, south; //============= Store the names of the divisions. =================================== east.name = "East"; west.name =…
Using C++ Language Write a program to implement the following: • Declare two C-strings str1 and str2 of appropriate sizes. • Use strcpy() to copy the string “Hello World.” into str1 • Using a suitable message, read the user input into str2. The user may enter more than one word. • Determine and store the length of both char arrays using strlen() • Check if both char arrays are the same length using the stored lengths o If they are the same length, tell the user they are the same length o If they are not the same length, tell the user the strings are different and end the program using a return statement. • Compare both strings using strcmp to check if they are the same string. o If they are the same string, inform the user of this o If they are not the same string, inform the user of this o Note that you compare only if they are of the same length, hence the return statement in the earlier step.
Looping Construct with Floating Point Numbers Write a program that utilizes a while-loop to read a set of five floating-point values from user input. Include code to prevent an endless loop. Ask the user to enter the values, then print the following data: Total Average Maximum Minimum Interest on total at 20% Answer:
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
11. In C++ programming language write a program to read 5 strings from the user and print the string with the maximum length in the output.
Hi this is a C program. I need you to convert it to a C++ program. make sure its working thank youhere is the program:#include <stdio.h>#include <string.h>int main(){ char pass[100], guess[100]; //character arrays to store inputs printf("input password: "); scanf("%s",pass); //input pass while(1) //infinite loop { printf("enter your password: "); scanf("%s",guess); //input guess if(strcmp(pass,guess)==0) //if pass and guess are same { printf("correct!"); //prints this message break; //exits from loop } else //if pass and guess mismatch printf("incorrect!\n"); } return 0;}
C++ program Write a program that will predict the size of a population of organisms. The program should ask the user for the starting number of organisms, their average daily population increase (as a percentage of current population), and the number of days they will multiply. A loop should display the size of the population for each day.
Instructions The python "try" keyword is very powerful in that it can, among other things, prevent a program from ending abnormally because of invalid numeric input. Write a python program with two functions/modules that does the following: .main() accepts input and calls a function to test if the input is a number and displays a message regarding the result of that numeric test • numTest() is passed an input string, tests to see if the string is numeric and returns the necessary information to main() . a NULL input (just pressing the enter key) ends the program . DO NOT USE THE BUILTIN PYTHON FUNCTION FOR NUMERIC TESTING Be sure to use clear prompts/labeling for input and output.