Please write a Java program , to write data into a file (output.txt). The output.txt file is below. 1 22
Q: You are awesome, in your own words how would you Explain in a sentence how to use a natural deductio...
A: The answer is given below.
Q: What are the mechanisms for handling interruptions and how do they affect machine operations?
A: Interrupt is a signal generated by hardware or software when an activity or event needs immediate at...
Q: A network administrator subnets the 192.168.10.0/24 network into subnets with /30 masks. How many eq...
A: Introduction: A network administrator subnets the 192.168.10.0/24 network into subnets with /30 mask...
Q: DO NOT COPY FROM OTHER WEBSITES Upvote guarenteed for a correct and detailed answer. Thank you!!!
A:
Q: What would the following Python code print out: x = "All our base belong to us" print( x[1:15:2] ) 2...
A: Please refer to the following steps for the complete solution of the problem above.
Q: Given the following transaction set describe the construction of FP tree in FP- growth algorithm Ite...
A: To construct FP tree.
Q: 1. Create a console program that will perform the following: Ask the user to enter the pieces of app...
A: Since programming language was not mentioned , so I chosen C++ I have provided C++ CODE along with s...
Q: Ex/ if the following message “paperx” is encrypted by using Hill cipher and converted into ciphertex...
A: The cipher key is the matrix used for encryption, and it should be selected at random from a collect...
Q: (2) How is capacity of a 12XCD-ROM given bit rate 150 KB/second, 80 minutes play time?
A: The capacity of CD-ROM = bit rate * Playtime here bit rate = 150 KB/second playtime = 80 minutes = 8...
Q: Is it because lists and sets are mutabl
A: nearly any type of value can be used as a dictionary key in Python. You can even use built-in items ...
Q: Write a program that asks the user to enter a 1st color choice from a set of options: red, yellow or...
A: In this program we have to enter a 1st color choice from a set of options: red, yellow or blue, andt...
Q: (a) A planar graph has 5 vertices and 3 faces. How many edges does it have? (b) A planar graph has 7...
A: Hi there, Please find your solution below, I hope you would find my solution useful and helpful. Tha...
Q: What is Microsoft Excel, and how does it work? Explain the basics of a spreadsheet.
A: Introduction: Microsoft Excel is a spreadsheet tool developed by Microsoft that is part of the Micro...
Q: Implement a doubly linked list. The name of the nodes of th node will have two data values (Name: st...
A: Code: #include <iostream>using namespace std; struct Customer {string name;double income;struc...
Q: To protect the sound quality of phone calls over a DSL network, what device must be installed?
A: To protect the sound quality of phone calls over a DSL network, what device must be installed?
Q: ate scripts for 2 or more websites that have similar functionality what would your automation approa...
A: Ans- We have two scripts which are automated - 1. Flipkart: from bs4 import BeautifulSoup as soup ...
Q: In a Layer 1 frame, what information is usually included?
A: Please find the detailed answer in the following steps.
Q: Question 4 What is a public IP address? 10.0.0.1/8 O 172.16.0.1/16 25.0.0.1/8 O 192.168.0.5/24
A: Answer : correct answer Option C 25.0.0.1/8
Q: To manage user security credentials, network administrators build domain groups for a variety of rea...
A: Introduction: A network administrator is an information technology expert who ensures that an organi...
Q: Explain your personal knowledge of In-House Development in your own words.
A: Answer : A group of individual dwellings or apartment houses typically of similar design are usuall...
Q: You are given an array A[1, ..., n]. Describe an algorithm (proper/efficient pseudocode required) th...
A:
Q: Explain insulin pump control systems with neat diagrams of hardware and activity model.
A: Explanation: In medical research, an insulin pump system is necessary to control the body's insulin...
Q: Explain the components of the spheres of security paradigm in detail. Each component should be expl...
A: The spheres of security paradigm were originally proposed by Michael Witte and Michael Nollwitz in 1...
Q: Describe the Deployment Models and do you think they should be taken seriously?
A: Deployment models allows the organization to identify the infrastructure and environment based on th...
Q: Higher Lower Guess a number between 1 and N Your guess: Guess
A: Data engineering function is one of the most important and integral field these days. It helps in co...
Q: why do we need to develop a BI strategy framework ? Give two resaons with brief explaination ? - whi...
A: Given: We have to discuss why do we need to develop a BI strategy framework. We have also discusse...
Q: Create a singly linked list of n nodes and display it in reverse order. Sample Output: Input the num...
A: According to the Question below the Solution: Output:
Q: What are the two most major benefits of Software Defined Networks over traditional Hardware-based ne...
A: Introduction: Varied vendors make various claims, but the most common benefits of software-defined n...
Q: Provide examples (as many as possible) of applications that use graphs.
A: A Graph is a non linear data structure consisting of nodes and edges. The nodes are sometimes also r...
Q: wanted to buy a tablet ome access (bag and keyboard Payment method: 30% of the amount paid in advanc...
A: The above given question is observed and the task is identified and is implemented as per the instru...
Q: What strategies and technologies are available for dealing with pre- and post-release defects?
A: Introduction: Pre-release defects are similar to pre-release bugs in that they are reported and corr...
Q: Write a program that takes in a positive integer as input, and outputs a string of 1's and 0's repre...
A: The while loop is used to iterate a part of the program repeatedly until the specified Boolean condi...
Q: Morning fam:) Would truly appreciate for your help on this one. Given the parameters : a = 22, b = ...
A: One of the algorithms used to generate false random numbers is Linear Congruential Generator.
Q: IP handles datagram fragmentation and reassembly, which are undetectable to TCP. Is this to say that...
A: Introduction: When data is present at a length that the system can handle, data fragmentation is the...
Q: Explain the concept of dynamic testing.
A: Dynamic Testing is a software testing technique using which the dynamic behaviour of the code is ana...
Q: Discuss how Python is used in Cybersecurity. Why is it important for students in the field of networ...
A: Cyber Security can be defined as a process using set of applications, with network and programming s...
Q: Write a C program to calculate the Volume of a cylinder. Also identify and display whether the cylin...
A: Here, first we will calculate the volume of cylinder and then check whether it is greater than 1000 ...
Q: A neural network of 2 convolutional layers each with 16 filters, kernel size = 2, stride = 1, and va...
A: A neural network is a network made up of neurons and perceptron’s. They have layers of three types n...
Q: Define software engineering and explore the importance of applying software engineering concepts to ...
A: Introduction: Software engineering is a discipline of computer science that focuses on the design an...
Q: The management a Company is considering to purchase an equipment. The equipment will cost $50.000 an...
A: Net Present Value Formula is NPV = Cash inflow / ( (1+i)t ) - Initial investmentwhere, i = return ra...
Q: Insert the missing part of the code below to output the string.
A: The above program is for printing the string in java . For printing a string in java we use System.o...
Q: Deck include 52 cards: and A to K meaning 1 t 13 // 1. create two list of cards (leftHand and righth...
A: #include<stdio.h> void take_input();int is_onepair(int player);int check_three(int x, int y, i...
Q: How open file txt in my computer
A: Introduction: TXT files, for example, maybe opened using Windows' built-in Notepad software by right...
Q: Peer-to-peer networks and server-based networks are the two fundamental types of network role catego...
A: A network can be denoted as a connection between various devices or systems or computer with each ot...
Q: A university XYZ wants to implement a network for their different departments such as Administration...
A: a. The suitable topology is Star Topology. Star topology is the cheapest, and easy to setup and inc...
Q: What is WebAppcomponent?
A: Introduction: With Web Components, a collection of diverse technologies, you may develop reusable cu...
Q: 21. Write a Python program to find the sum of the digits at unit places of all the elements in the g...
A: Write a Python program to find the sum of the digits at unit places of all the elements in the given...
Q: o protect the sound quality of phone calls over a DSL network, what device must be installed?
A: ANSWER:-
Q: What is the difference between a Microsoft Access database and an Excel spreadsheet based on their c...
A: Introduction: Spreadsheet in Microsoft ExcelMicrosoft Excel is used to show the data in horizontal a...
Q: Somie, a leader of the underworld, was killed by one of his own band of four henchmen. Detective Sha...
A: Here we have given the answer with explanation in step 2.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAAThe file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionCreate methods "read" and "write" methods to handle the input and output to files. in Java
- 3. Factorials/MathUtils File Factorials.java contains a program that calls the factorial method of the MathUtils class to compute the factorials of integers entered by the user. Save these files to your directory and study the code in both, then compile and run Factorials to see how it works. Try several positive integers, then try a negative number. You should find that it works for small positive integers (values < 17), but that it returns a large negative value for larger integers and that it always returns 1 for negative integers.Returning 1 as the factorial of any negative integer is not correct—mathematically, the factorial function is not defined for negative integers. To correct this, you could modify your factorial method to check if the argument is negative, but then what? The method must return a value, and even if it prints an error message, whatever value is returned could be misconstrued. Instead it should throw an exception indicating that something went wrong so it…This is for Python version 3.8.5 and please include pseudocode. A file named gang.txt is shown below. Write Python code that opens this file, reads only the first two lines, and prints “Penny is 19” gang.txt (contents of file) - please create on with the data provided in order to complete this question. Thank you! Penny 19 Kenny 20 Benny 21 Jenny 20Do the following program in Java Eclipse:A veterinarian services many pets and their owners. As new pets are added to the population of pets being serviced, their information is entered into a flat text file. Each month, the vet requests a listing of all pets sorted by their outstanding bill balance. You have to write a program to produce a report of animals and their owners sorted by theiroutstanding bill balances from the data in the flat text file. Below is a description of the information on the text file:• The first entry is the number of animals on the file (numeric)• The fields below repeat for each animal:o Owner name (String)o Birth year (numeric)o Bill balance (numeric)o Species (String)o Special feature (numeric or String)The animals serviced by the veterinarian are of four types: mammals, fish, birds, and reptiles.For a mammal, the special feature field on the flat file is the number of legs of the animal (numeric).For a fish, the special feature field is the type, bony,…
- This is a python file Fix this code and the output is the attachment #filename: modValidateEmail.py def isValidMSUMEmail(email): if email.count('@') != 1: return False tmp= email.split('@') if len(tmp) == 0: return False userName = tmp[0] if not userName[0].isalpha(): return False for c in userName: if not c.isalpha() and c != '.': return False inst= tmp[1] if inst != 'mnstate.edu': return False else: return True #filename: UnitTestValidEmail.py from unittest import * from modValidateEmail import * class TestValidEmail(TestCase): #create a subclass of unittest.TestCase def testUserName(self): self.assertEqual(isValidMSUMEmail('.joe@mnstate.edu'),False) self.assertEqual(isValidMSUMEmail('joe4@mnstate.edu'),False) self.assertEqual(isValidMSUMEmail('joe$smith@mnstate.edu'),False) self.assertEqual(isValidMSUMEmail('joe.smith@mnstate.edu'),True) def…OBJECT ORIENTED PROGRAMMING LESSON LABORATORY EXERCISE-1 Problem: Write a program that takes position and current salary value from the user and calculate the new salary and shows it on the console according to the following table. Position Manager Salesman Human Resources Technician Headman Example: Enter your position: Manager Enter your current salary: 10000 New salary: 11000 Raise Percentage %10 %20 %15 %25 %23 Write your program using Java and copy your codes to a text file which has your name and surname. Then load it into UZEM under the provided link.*CODE SHOULD BE IN JAVA* A personal phone directory contains room for first names and phone numbers for 30 people. Assign names and phone numbers for the first 10 people. Prompt the user for a name, and if the name is found in the list, display the corresponding phone number. If the name is not found in the list, prompt the user for a phone number, and add the new name and phone number to the list. Continue to prompt the user for names until the user enters quit. After the arrays are full (containing 30 names), do not allow the user to add new entries. Use the following names and phone numbers: Name Phone # Gina (847) 341-0912 Marcia (847) 341-2392 Rita (847) 354-0654 Jennifer (414) 234-0912 Fred (414) 435-6567 Neil (608) 123-0904 Judy (608) 435-0434 Arlene (608) 123-0312 LaWanda (920) 787-9813 Deepak (930) 412-0991
- In Java C++Write a code assessing a txt file consisting of id numbers. It should asses the given id numbers if its valid. An ID number can be considered valid given below. The following numbers are (imagine that the numbers are in a txt file)12034562120238471204562312067282120371891293042812047281129374911283920112013818It must be divisible by 11 given the formula below.The output will be the number of valid and invalid numbers. 11191031 = 1*8 + 1*7 + 1*6 + 9*5 + 1*4 + 0*3 + 3*2 + 1*1 = 77sum of the products must be divisible by 11 for it to be valid.12 Digit Barcode In this homework, you will develop a python program which reads a series of barcodes from "barcodes.txt" and creates an output file "output.txt" which contains the barcodes and their status as seen in the example output below. 153182953420 5+1+2.5.4-1 7+3+8+4+3+2-3 1 23601057072 6+t-13 Even : 2+6+1 +5+0 = 14 Odd: 1+3+0+ 0 +7+7 = 18 3 x8 = 24 D+3- 10 4 + 4 = 8 10 -8 = 2 (CORRECT) What to submit: 1) ipynb file which contains checkBarcode function which takes a string varlable as input and returns true or false, and a driver program which reads in "barcodes.txt" and creates "output.txt". Assume the input file contains one barcode info per line. Important: Your input file name MUST BE "barcodes.txt" and the output file name MUST BE "output.txt". Otherwise, you'l get up to 30 pts penalty Below a sample output.txt: 123601057072 is a valid 10-digits barcode lab601057072 is an invalid 10-digits barcode 172601055072 is an invalid 10-digits barcode 12345 is an invalid 10-digits…I have the following contents in my JSON file: [{"username":"JohnLegend","date":"03/29/2023","time in":"7:00 am","time out":"4:54 pm"}] Please give me a JAVA code that will allow the user admin to generate report on the accumulated hours rendered by all employees in a given period of time.