Please answer both questions

Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…

A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…

Q: 17 Match the number of the label in the diagram below with the appropriate site or structure from…

A: Electron transport chain Also called the ETC is composed of four protein complexes. These protein…

Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…

A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…

Q: From the choices below, which are reputable sites that can be used to locate scientific journal…

A: Science is a term which is used for the study of the subject which is based on the facts and…

Q: Part 1: Graphing Biotic Potential 1. Make a table to show the data (# flies/generation). for one…

A: Given that one female fly can produce 120 eggs in one generation. Of these 120 eggs, half (60) will…

Q: 3. What would happen if there was not a lot of variety in the bears when they first reached the…

A: Answer 3. If there is not a lot of variety; when they firsr reached the island; It leads to the…

Q: 22) If both married couples have the sickle cell trait (AS), what is the possible combination of…

A: The mode of inheritance is a pattern of obtaining parentral alleles  or genes to the offsprings. The…

Q: The photomicrograph below shows mitotically dividing cells from whitefish (Coregonus lavaretus). a.…

A: Mitotic division: it is also known as equal division because each daughter cells have a copy of…

Q: A female Drosophila fly is heterozygous for three recessive pigmentation mutations called pk, bk,…

A: Gene expression is a process in which the genetic instructions of genes are utilized to manage…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: Directions: Read the paragraph and answer the questions. Write your answer on a separate paper.…

A: Answer 1- the mothers of 3 and 6 are carrying the gene of haemophilia as recessive alleles. They do…

Q: Digestive Enzyme Activity Tan-protease ...... - W-protease --- 4 8. 10 12 pH Based on these data and…

A: In this question, scientist identified two enzymes which are found to function in the digestive…

Q: The net primary productivity of a temperate deciduous forest is approximately 180,000 kcal /m2 /…

A: In the ecosystem the producers are the organisms that can trap the solar energy and convert them…

Q: Use the following information to answer the question: Many species of food crops have been…

A: Organisms and their environments are inextricably linked and interdependent. Every alteration in the…

Q: When you examine the phenotype of wings - why can you conclude that wings & flight are analogous…

A: Change in visible characteristics of an organism which takes place from many generations is called…

Q: om college and started working at a biotech startup called Scrofa first job assignment is to clone…

A: Prolactin is defined as a hormone by the pituitary gland at the bottom of the brain. Prolactin…

Q: 3. What would happen if there was not a lot of variety in the bears when they first reached the…

A: The theory of evolution by natural selection, first formulated in Charles Darwin's book "On the…

Q: 4)In 2018, the atmospheric concentration of CO2 was 408 pm, and the concentration of methane was…

A: Parts per billion (ppb) is a unit of measurement used to express the concentration of a substance in…

Q: stop codon. C Chr1 Bace2 180 180 Exon 1 Exon 2 Exon 3 Exon 5 Exon 7 Exon 9 Exon 4 Exon 6 Exon 8 200…

A: Nucleotides in DNA are arranged in exons or introns. Exons are the coding sequence whereas introns…

Q: Examine the table showing the classification of four questions. Taxon Domain Kingdom Phylum Class…

A: Classification is the process of grouping things together based on shared characteristics. In…

Q: 1. =lemg/ The order is for 200 mg. The label reads 250 mg/5ml. You would give ml The order is for…

A: Given: Order for 200 mg, Label: 250 mg/5ml. To Find: Amount in ml.Given: Order for 500 mg, Label: 1…

Q: nswer any three.

A: As we know Hemoglobin is a product made from heme+globin. The presence of heme gives the red color…

Q: . Other polar molecules include nucleic acids and some proteins. Look at the DNA sketch provided and…

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: Which of the following changes or mutations can be acted upon by natural selection? For each choice,…

A: Evolution is the gradual accumulation of changes in organisms over a period of time. The theory of…

Q: Lactose exists in two Why?

A: Disaccharides are made up of two monosaccharides. Lactose is a disaccharide made up of glucose and…

Q: Dialysis bag in beaker Cell in beaker 2M Na+ 2M Na+ 2M CI- 2M glucose 2M starch 2M CI- 2M glucose 2M…

A: a) At the beginning the osmotic concentration of dialysis bag is (2+2+2+2)=8M. And the osmotic…

Q: Which image shows the type of leukocyte responsible for antibody production? D O D O E Submit…

A: Introduction Leukocytes (also known as white blood cells) are a type of blood cell that lacks…

Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…

A: This question is about interpreting a scatter plot with a regression line from an experiment that…

Q: 53. A NURSE IS REVIEWING THE MEDICAL RECORD OF A CLIENT WHO HAS OSTEOPOROSIS AND HAS REQUESTED…

A: Note: Since you have posted multiple questions, we will provide the solutiononly to the first five…

Q: Please answer both, thank you

A: During gastulation of embryonic development the process of formation of neural tube  is called…

Q: I need help with the two questions attached below

A: The rate of biomass production  in a particular habitat, at particular unit time  is called…

Q: D) The concentration of this ion and negatively charged proteins is much greater inside the cell…

A: The Neuron's membrane consists of sodium to be present in large quantity in the extracellular part…

Q: Question 14 Short regions of chromosome 1 were sequenced in a population of C. elegans. These…

A: INTRODUCTION The three common haplotypes are shown, along with their frequencies in the population.…

Q: 15. LO1.3 The respiratory systems primary function is to: a. Fight infection. b. Warm the air. c.…

A: Physiology is the study of normal functions within the living. It involves the study of various…

Q: 2. (A) What is the name of the key orexigenic neurons in the arcuate nucleus ARC. (B) These neurons…

A: The central nervous system (CNS) is one of the two major divisions of the nervous system. It…

Q: Starting appear in squalene. 14 H3C COA 5.) Starting with the following radiolabeled acetyl-CoA map…

A: Introduction: Biosynthesis of cholesterol occurs from the acetyl-CoA in four stages.

Q: Which of the following is not true of diabetic retinopathy? retina blood vessels swell blood glucose…

A: Answer 1 Option C is correct :  Higher than normal HDL cholestrol levels

Q: How many mice will die during fetal development? Show all your work and round your answer to the…

A: INTRODUCTION Hardy Weinberg equilibrium This principle states that genetic variation in a population…

Q: According to your textbook, considerable body of evidence link added dietary sugar to…

A: Carbohydrates are the macromolecules consisting of carbon, hydrogen and oxygen as the key elements.…

Q: SUGAR AND WATER EXPIRIMENT 1. Make sure the glasses have an equal amount of water. Put a sugar cube…

A: Water  It is the most important material on the planet eart. Water makes life possible as almost…

Q: 1. Gene expression can be regulated at the level of a) transcription b) RNA stability c) translation…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: Which part of the brain helps prioritize sensory information?

A: As we know brain is a network of billions of neurons which carry information and transport them in…

Q: What are some recommendations to clinicians interested in incorporating body composition methods in…

A: Introduction :- Body composition means that the chemical compounds that makes up the human body , in…

Q: One of the biggest obstacles to the widespread use of ultrasound for body composition estimation in…

A: Impedance is defined as the resistance to current flow. The bioimpedance devices/techniques employ…

Q: What organism did Vries used as evidence to prove that species did change as Darwin said? * evening…

A: Question number 1 On the basis of above observations, Hugo de Vries (1901) put forward a theory of…

Q: An uncatalyzed reaction has a rate of 4.2 x 10-7 sec-1. When an enzyme is added the rate is 3.2 x…

A: Enzymes are proteins present inside organisms, which function to work as biological catalysts. These…

Q: Question 1 (1 point) Which statement(s) about the lac operon in E. coli is correct? O A) It is an…

A: The lac operon in Escherichia coli (E. coli) is a well-known example of gene regulation in bacteria.…