20 Question 20XXIXX!ProteinsProteins are determined by the structure of DNA and RNA. DNA consists of two chains of nucleotides held together by chemical bonds. Base pairing rules determine how the bases of each chain will bond to one another. RNA also hasrepeating nucleotides, bases that are held together by chemical bonds, and specific base pairing rules, but it is a single strand and has different bases than DNA. The sequence of DNA is rewritten into an RNA copy which then determinesthe sequence of amino acids of a polypeptide chain, the primary structure of a protein. A single amino acid is added to the protein strand for every 3 bases, or codons, in the RNA. The sequence of amino acids determines the way theprotein will fold. The folding of the protein determines its function. The structure of DNA, RNA, and a protein are shown.DNAFirst nucleotideUсAGThe triplet codon used to decipher the amino acids is mostly universal. Each amino acid has more than one codon. Methionine (AUG) is the initiation codon that starts the translation process. There are 3 codons that stop the translationprocess.UUUUUCUUAUUGCUUCUCCUACUGRNAGUUGUCGUAGUGU(PheLeu(LeuAUUAUCAUAAUG (Met)lleProteinValUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGSerPauseProThrQSecond nucleotideсAlaFoldedproteinQ ZoomCAUCACCAACAGUAUTyrUACUAA STOPUAG STOPAAUAACAAAAAGAGAUGACGAAGAGHisGln(AsnLysAspGluUGUCysUGCSTOPUGAUGG TrpCGUCGCCGACGGAGUAGCAGAAGGGGGUGGCGGAGGG(Arg)SerArgGlyUсAUGAGThird nucleotideThe following question has two parts. First, answer Part A. Then, answer Part B.Caused by a mutation, sickle cell anemia is a disorder that affects hemoglobin, the red blood cell molecule that carries oxygen to cells throughout the body. The ß chain of the hemoglobin protein is asingle chain of amino acids and is 147 amino acids long. In humans, the gene that encodes for the ß chain is located on chromosome 11. The diagrams show the DNA, RNA, and amino acid sequence ofan unaffected person and a person with sickle cell anemia.Unaffected personGAC TGA GGA CTC CTCAmino Acids -Leu-Thr - Pro-OOOAmino AcidsA.ODNAB.RNAC.D.DNAPart A:Where does the mutation that causes this disorder occur?CUG ACU CCU GAG GAGPerson with sickle cell anemiaRNAGlu - GluGAC TGA GGA CAC CTCCUG ACU CCU GUG GAG-Leu-Thr -Pro-Val-GluThe mutation occurs on the DNA.The mutation occurs on the RNA.The mutation occurs on the ribosomes.The mutation occurs on the amino acid.Part B:Which BEST describes the result of this mutation?A. The entire sequence of amino acids is changed.OB. The RNA strand does not code for the correct amino acids.Q Review / ✓ Finish TestOC. The change in amino acids shortens the polypeptide sequence.ABC

Name: 20 Question 20XXIXX!ProteinsProteins are determined by the structure o
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 20 Question 20XXIXX!ProteinsProteins are determined by the structure of DNA and RNA. DNA consists of two chains of nucleotides held together by chemical bonds. Base pairing rules determine how the bases of each chain will bond to one another. RNA als