AUG Met ACGANALYSISANALYSIS:A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template isgiven below:Parent strand DNA:5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3DNA daughter strand:hnRNA:MRNA:original protein:mutated MRNA:mutated protein:second letterGUCUUUU PheUAU TyrUGUUGC CysUAA stop UGA stop| AUAG stop UGG TrpUUCUCCUACSerLeu UCAUUGUUAUCGGCUUCCUCAUCGUHisCACCAACUCCCGCLeuCUAProArgAССАCGAGlnCAGCUGCCGCGGAUUACUAAUAUC lleAAUAAAC AsnAAAAGCAGAAGUSerACCThrАСАAAG LySGAU ASPAUG Met ACGAGG ArgGGUUGCUGGU)GUCGCCGACGGCValGUAGCAAlaGAAGlyGGAAGluGUGGCGGAGGGGGTranslating the unmutated MRNA that was obtained after splicing, the original protein sequence will be?The original protein is [A](For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H).first letterthird letter

Replication occurs in a bidirectional manner. Always happens in the 5'→3' direction because…

Answered: Parent strand DNA:…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Chromosome initiated has following sequence ab*cdefg *= centromere draw the chromosome that would result from the following mutations a paracentric inversion that includes defg b peri centric inversion of bcde
?Q4/ Give main function of nucleus
DNA Typing U S₁ S₂ U S₁ S₂ U S₁ S₂ U S₁ S₂ 0000 Locus 2 Locus 3 Locus 1 U S₁ S₂ 1. In Figure 1.16, blood samples are taken from a gate (U), an injured woman (S₁), and her former husband (S₂). The woman claimed that she was attacked by her former husband. The man had a cut on his hand, which he explained as a cut from a broken water glass. Is the unknown sample from her wound, from her former husband, or from an unknown third person? Locus 1 U S₁ S₂ Locus 2 U S₁ S₂ Locus 4 Locus 3 U S₁ S₂ FIGURE 1.16 Locus 4 FIGURE 1.17 2. From the same case, a second blood sample was collected from a stain on the floor of the former husband's home (Figure 1.17). Is this stain from the woman, her former husband, or an unknown third person?
U UUU UAU 11yr Phe UUC UUA Leu UUG Jle UCU UCC UCA UCG UGU UGC Cys UGA Stop UAG Skop UGG Trp UAC Ser UAA Stop CUU CUC CỦA CUG CAU JHis CAC CGU CGC CGA CGG CCC Leu Pro Arg ССА Delete CCA CG CAA CAG JGIN Gln AUU AUC le AUA AUG Met AGU 1 Ser AGC AGA AGGJArg 1. ACU ACC The ACA ACG AAU M AAC AAA AAG Jlys JAun ATG AAC TAC CTA GGG ACA GAU JAsp GAC GAA GAG JGlu GUU GUC Val G GUA GCU GCC GCA Ala GCG GGU GGC Gly ATG ACC TAG GGA CA GGA GGG GUG G. Compare translation before and after the deletion. What effect might it have on gene function? Asp Daspartic acid lleI isolcucine Thr T threonine Leu L leucine Ser S serine Туr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Lys K Arg R Gly G glycine lysine Ala A alanine arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Second Position UGU 1Cy UCU UCC Ser UCA UG UUU Phe UAU UAC Ty UAA Slop UGA Stop UAG Slop UGG Trp UGC UUC U UUA Leu ] low UUG CUU CÚC A Leu CCU CCC Pro…
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 311. If the above DNA strand is the coding (sense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where,a. the 15th base was replaced by Guanine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?b. the 18th base was replaced by Guanine. Is there an effect in the structure and function of the synthesized protein, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion…
-Centrosome Cell DNA Telomere- Thymine - Cytosine Place the number that represents the base, cell structure, or unit of inheritance in the blank beside each. Adenine Guanine Chromosome Nucleus
Please answer all the question. I dont need the explanations. Thanks!
Figure 1 shows that remdesivir "mimics" an important component of RNA replication. Which component of RNA replication has a structure similar to that of remdesivir?
Write down the complement strand of DNA for the following sequence and place the 3' and 5' on the appropriate ends. 3' - GGGCCTAATATAGCTTTACGGTAT - 5'
Page 1: Second Letter C 1 2 UUU U UUC UUA Phe UCU UCC UCA UCG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop UGG Tyr -- Ser Leu Stop A Trp G UUG CUU C CUC CCU Leu cc CAU His CGU Pro CAC CGC Arg CUA CUG CCA CCG 1st СА Gln CGA CAG CG 3rd letter AUU A AUC AUA AUG ACU ACC ACA AGU Ser AGC u letter AAU AAC AAA AAG Asn He Thr AGA AGG A Arg G Lys Met ACG GUU G GUC GUA GUG GCU GCC GAU Asp GGU GGC U Val GAC GAA GAG Ala Gly GCA GGA GGG Glu GCG 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5' a. direct transcript? b. transcript for translation? c. direction of a? (3' to 5' or 5' to 3') d. direction of a (3' to 5' or 5' to 3') e. translated peptides?
Can you help me answer this?
- log₁0 (P) 52- 44- 35- 19- 10- • NEGR1 PKHD1 OR6B1 SNP NEGR1 Ne/ne PKHD1 Pk/pk OR6B1 Or6/or6 +0.7 DNAJC1 Dn/dn +0.1 OR10G3 Or3/or3 -0.3 DNAJC1 +0.2 -0.1 chromosome 10 11 12 OR10G3 ¡ Figure 1: Shown are the genome-wide association results for fresh fruit consumption in a large sample of Americans. The dotted horizontal line is the genome-wide significance cutoff. 13 14 15 16 17 18 19 20 21 22 23 Alleles Effect size Table 1: Effect size (in servings) on fruit consumption per day of alleles at the loci labelled in Fig. 1. Effect sizes refer to the first (capital letter) allele; lower case alleles have a value of 0.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS

Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-CT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: