Outline the pathogenesis of Myasthenia gravis and the consequential effects from the disruption at the neuromuscular junction. Is Myasthenia gravis considered an upper or lower motor neuron disorder?

Q: What are the big differences between eukaryotic (nuclear) and prokaryotic genomes?  How do…

A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…

Q: Penicillium chrysogenum Morphology Picture attached. Description : 1. Conidium 2. Sterigmata 3.…

A: Penicillium notatum is a type of fungi.It comes under phylum ascomycetes.It can reproduce by all…

Q: Discuss the various definition of  morphology. 2.What is your own definition of morphology?

A: We can classify and identify different organisms in different aspects.We can classify them using…

Q: Describe an experiment to test whether soil pH affects the growth rate of sunflowers. Include all of…

A: Research can reveal gaps in our knowledge and understanding of plant development, guiding future…

Q: Genetic and genomic research can have social and environmental implications.

A: Genetic modifications do have environmental implications which can be observed from the given graph.…

Q: describe the mechanism of how tissue damage leads to pain and how NSAIDs therefore provide…

A: Pain is a complex sensation that can be caused by various factors, including tissue damage. When…

Q: 2. Large predatory marine fish (ex: tuna, swordfish, marlin, shark, etc.) usually eat at the third…

A: Large predatory marine fish, such as tuna, swordfish, marlin, and shark, are often considered…

Q: Dihybrid Crosses - Genotypes NOW YOU KNOW THE RULES - FOR EACH PHENOTYPE SHOWN IN THE PICTURES, WORK…

A: Introduction A gene exists in two alternative forms known as allele. When both the alleles are same,…

Q: You inspect an ear of corn and find the following number of kernels: 461 red and starch, 142 red and…

A: Genotype is the genetic constituent of an organism. It is a specific genetic makeup of an organism…

Q: The physician has ordered acetaminophen every 6 hours for a child weighing 10 lbs. The…

A: Recommended low dosage of acetaminophen= 200mg/kg/24hrs Weight of the child= 10lbs= 4.5kg

Q: 7. Which stage of cell division contains the most amount of DNA? Telophase Prophase Cytokinesis None…

A: The cell cycle is the sequence of events that a cell goes through as it grows and divides. The cell…

Q: Differentiate between pro-insulin and mature insulin

A: Pancreas is the gland,which releases the hormone insulin.It is basically the beta cells of…

Q: Predictions are statements about the evidence you might expect if a hypothesis was supported.…

A: In order to determine how a specific phenomenon occurs, what is the process behind an event,…

Q: How is it possible for aphids to feed only on the carbohydrate-rich but nutrient-poor sap of phloem…

A: Microbiology: The science of micro creatures' biology includes viruses, bacteria, algae, fungus,…

Q: Respiratory droplets and aerosols are the same thing.   Question 19 options:   a) True   b) False

A: ANSWER) Aerosols are the smallest units of droplets, many aerosols come together to form a droplet.…

Q: Choose the false statement regarding the scientific method. The scientific method is used to test…

A: The false statement is: The scientific method is used to test hypothesis and observations.

Q: Angiosperms are considered to be the most highly evolved land plants. Discuss how angiosperms are…

A: Angiosperms are a diverse group of flowering plants that are characterized by their reproductive…

Q: What about the references?

A: If we see around us there so much there to explore and learn. Science allows us to understand things…

Q: Filarid (microfilaria) parastites in lymphatics would most often cause which of the following…

A: A parasitic condition known as filariasis is brought on by an infection with roundworms of the…

Q: Questions 1. Who are the characters in this real-life scenario? What medical situation does each of…

A: We all know that our all physiological information are stored in our genetic material,DNA.But if…

Q: 1. (a) In diploid organisms, haploid cells or gametes are produced by meiosis. Fig. 2.1 shows…

A: Introduction:- Meiosis is the process in which a single cell divides twice to form four haploid…

Q: explain the most likely steps of what might happen inside a MDA-MB-231 cell after it is exposed to…

A: Nowadays cancer is a very common lifestyle disorder.Among females breast cancer is one of the most…

Q: 4. In guinea pigs, the genes for coat texture and coat colour are found on separate chromosomes. The…

A: Given, allele for rough coat is dominant over allele for smooth coat, i.e., R - Rough and r -Smooth.…

Q: 1. In pea plants, round seeds (R) are dominant to wrinkled seeds (r). A homozygous dominant plant…

A: The genotypes of a specific cross or breeding experiment are predicted using the Punnett square, a…

Q: Explain why seasonal stratification of temperature and oxygen takes place in deep ponds and lakes.

A: The propensity of lakes to generate separate and distinct thermal layers during warm weather is…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: Compare and contrast life cycles of plants (pteridophytes, gymnosperms, angiosperm), animals, fungi…

A: Life cycles describe the progression of developmental stages that an organism goes through, from its…

Q: The genetic diversity of the moss Polytrichum commune was analysed in two peat bog ecosystems.…

A: A species' genetic diversity refers to the variation in its genes and genotypes. It is critical for…

Q: Can you Describe in 1500 words, Planning Cycle for a Health Program?

A: Health program basically means to provide basic preventive ideas to prevent the spread of…

Q: RNA: Using the two ribonucleotides you chose, draw the two monomers bound together into a compound,…

A: Introduction -  RNA is a polymer composed of RNA Nucleotides.Each "Nucleotide" is made up of 3…

Q: at is meant with the interplay of hormones?

A: Hormones are secreted from endocrine glands. Endocrine glands are ductless glands which secrete…

Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…

A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…

Q: You have consumed a six-pack of beer in the course of an evening. The intake of alcohol can decrease…

A: Hormones are chemical signals that are directly secreted into the blood, where they are transported…

Q: In some chickens, the gene that produces color shows incomplete dominance. The gene will produce…

A: Incomplete dominance is a form of intermediate inheritance in which one allele for a specific trait…

Q: DNA and RNA are different because: DNA is made of 4 bases, while RNA is made of 5 bases. DNA is…

A: DNA stands for Deoxyribonucleic acid; which contains cytosine, thymine, adenine and guanine as…

Q: Adipose tissue under microscope labeled diagram with magnification calculations

A: Adipose tissues are basically fat-storing cells of the body that help in energy homeostasis. These…

Q: A person infected with an infectious agent, able to transmit disease but is asymptomatic without any…

A: Several bacteria, viruses and parasites can cause harmful infectious disease. It is important to…

Q: A cell in G1 of interphase has 8 chromosomes. How many chromosomes, and how many DNA molecules will…

A: A cell's growth and division are accompanied by a sequence of processes known as a cell cycle. A…

Q: How can you tell if a protein is stably expressed over time by looking at a pulse-chase analysis gel…

A: Pulse-chase analysis is a method used to study protein synthesis and turnover in cells. In this…

Q: Name the three connective tissue sheaths that surround a peripheral nerve. Which of these coverings…

A: Neuroregeneration: The regrowth or repair of neural tissues, cells, or cell products is referred to…

Q: draw the p21 promoter in a cell without E2F

A: Promoters are crucial for regulating gene expression, as they determine when, where, and how much of…

Q: What type of bond occurs when electrons are transferred between atoms? hydrogen bonds double bonds…

A: ANSWER)  Covalent bonds- The bonds formed between the atoms when the participating atoms share equal…

Q: When a food handler doesn't wash their hands after using the bathroom and introduces noravirus…

A: Introduction  Any change in the body's physicality or function causing discomfort or disability is…

Q: 1. Discuss the excretion and retention of proteins by the glomerulus.

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: During double fertilization, one sperm will unite with the egg, forming a zygote. As mentioned in…

A: Introduction: In the process of flowering plant reproduction known as double fertilisation, the egg…

Q: 3. The figure below depicts a protein folding into its final shape. If this was a cytoplasmic…

A: Proteins are sequence of amino acids that fold in their own conformation to perform it's function.…

Q: Compare and contrast the 2 systems that your body uses to coordinate the activity of body cells.…

A: The two important systems of the body that coordinate activity are the nervous system and the…

Q: 2. In Glycolysis, glucose is broken down into 2 pyruvate molecules, how many ATP are needed to…

A: Glycolysis is the process that helps to produce pyruvate from glucose. This process is much needed…

Q: In mice, grey coat is dominant: albino coat is recessive. A grey mouse mated several times in…

A: Understanding patterns of characteristics transmission requires knowledge of the fundamental…

Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…

A: First let's try to understand these terms clearly: