Only silenced DNA is wrapped around nucleosomes, active DNA is loose in the nucleus.

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: بار در انبار الدولة ر

A: The ECG or electrocardiogram is a test that is used to detect the heart rhythm and electrical…

Q: ng 1.3 Check Your Understanding . Study the fish aquarium system at the right. a. List at least six…

A: An aquarium can be described as a closed artificial ecosystem in which fish and plants are able to…

Q: Label a and b asap

A: We can say that Animals are defined as a group of eukaryotic multicellular organisms where they…

Q: E

A: A gland can be defined as an organ that is capable of producing a substance that helps in performing…

Q: more?

A: Introduction :- Reflexes are innate, automatic, and rapid responses to specific stimuli that occur…

Q: what the most appropriate outcomes after cataract surgery?

A: Cataract surgery is a medical procedure performed to treat cataracts, which are a clouding of the…

Q: Which of the following choices is NOT correct? There are three types of cartilages B. Lipids are…

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…

Q: label

A: Histology is the investigation of the microanatomy of cells, tissues, and organs as observed through…

Q: FAILURE TO THRIVE

A: Failure to thrive is a descriptive term and is not actually a diagnostic term. This term is used…

Q: Identify # 50 50.

A: Central nervous system includes brain and spinal cord. It is formed by neurons and supporting cells…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: DISBAILITY

A: Disability refers to a physical, sensory, cognitive, or mental condition that significantly impairs…

Q: Can you help me identify the white box locations?

A: The cardiovascular system is an organ system which distributes blood to all the parts of the body…

Q: meninges

A: Meninges are the membrane structures that cover the brain and the spinal cord. There are three…

Q: Thoughts on vaccinations

A: The use of vaccinations or vaccines is essential for suppressing the spread of infectious illnesses.…

Q: What about the references?

A: If we see around us there so much there to explore and learn. Science allows us to understand things…

Q: A C D E-

A: A-Efferent arteriole B-afferent arteriole C-glomerular capsule D-distal convulated tubule E-afferent…

Q: Fibrocartilage (____×)Location _______________________ Function _______________________

A: As we know human body is made of skeleton. Skeleton is structure that keeps body in shape and helps…

Q: Definition of IP3

A: Cell signaling is the process of communication between cells. It occurs with the help of various…

Q: of the following images show a carbohydrate? Note: molecular biologists have many different ways o…

A: Biomolecules are the molecules of life. Small sized biomolecules are called as biomicromolecules.…

Q: functional segmentation

A: Segmentation is the division of the body of some animals and plants into repetitive segments.…

Q: Long term neuropathic pain management

A: Pain may be the most common reason people seek medical attention. If constant and unrelieved, pain…

Q: Which letter represents the corpus spongiosum? -B -D OD O A CDE

A: Introduction: The male reproductive system comprises the following: A pair of testis Accessory…

Q: did Dr. Sergio Canavero exceed medical innivation with his head transplant?

A: Dr. Sergio Canavero of the Turin Advanced Neuromodulation Group (TANG) in Italy announced his…

Q: Would nlap it was exposed to a chemical that blocked its voltage-gated sodium channels so that they…

A: Membrane potential : It is a potential gradient that forces ions to passively move in one direction.…

Q: Questions: 1. Select a discrete colony. Describe the appearance of the colony. 2. Describe the…

A: The study of bacterial cultures is an interesting aspect of microbiology. It includes the cautious…

Q: Symptoms/problems for treacher Collins Syndrome

A: Treacher collins syndrome is usually a genetic disease that causes the underdeveloped facial bones.…

Q: Which organ is responsible for excretion of urine from the bladder? B -C

A: Human excretory system is a biological system which function to remove unnecessary materials from…

Communication

Communication is a method of transferring information between two persons or organisms. Communication is possible using mutually understood behaviors such as signs, symbols, or language. In the year 1980, S. F. Scudder proposed communication theory. According to his ideas, all living beings on the earth communicate, but the methods of communication differ. Communication skills are now part of soft skills.