-Onion skin

Q: Explain the purpose and phase where cells lose flagella and motility in biofilm formation, and why t...

A: There are several steps associated with the biofilm formation. The first step includes adherence of ...

Q: it

A: Warrier and her collaborator, Jessica Hendy and archaeological scientist at the University of York, ...

Q: 1. Explain how these body system help in maintaining homeostasis.  a.Digestive System- b.Skeletal ...

A: Homeostasis:- Homeostasis refers to the tendency to maintain internal body temperature or is a self-...

Q: One genotype in a very large and genetically variable population is favored in warmer than average y...

A: The correct answer is option (B) genetic variation will decrease as the genotype with the highest a...

Q: Which is the LAST part of the retina that a photon passes through before it is captured by an opsin ...

A: The retina is a layer of tissue in back of the eye which senses light and sends images to brain. 

Q: 1. To create a fully functional protein, how do their structure help in determining its function? 2...

A: 1. A fully functional protein is generally found in tertiary or quaternary structure. The tertiary p...

Q: Discuss the possibility that tundra species could dodge the climate change bullet simply by adapting...

A: The tundra biome is characterised by its chilly and icy landscape. This biome has a brief growing se...

Q: Define the following: 1.  Morphology -  2.  Colony -

A: Colony morphology refers to the visible cultural features of a bacterial colony on an agar plate. In...

Q: А C

A: Morphology: The metacercariae, O. felineus has the similar morphology to those of the liver flukes. ...

Q: The electrochemical gradient across the plasma membrane Group of answer choices is caused by more s...

A:     sodium concentration is more in outside the cell than the inside of the cell.  Sodium potassium ...

Q: Imagine you pull away the cover slip and drip 10 drops of deionized water on the young Elodea leaf, ...

A: Plasmolysis can be reversed if the cell is placed in a hypotonic solution. Stomata help keep water i...

Q: Explain how the three major types of deserts differin their climate and vegetation. Why are desert e...

A: Hi! Thank you for the question, As per the honor code, we are allowed to answer three sub-parts at a...

Q: How do we know that bacteria regulate the expression ofcertain genes in response to the environment?

A: Regulation of gene expression in prokaryotes occurs at several levels such as transcription and tran...

Q: 74. Copy Table 2 into your notebook. List three types of steroid molecules, and explain their purpos...

A:    INTRODUCTION      STEROIDS             Steroids are lipids. They are hydrophic and it is insolubl...

Q: 1. Molecule #1 a)What Group? (Carb, Lipid, Protein, or Nucleic b)Acid). Within the group, how would ...

A:

Q: 4. If several pea plants with the genotype TTYY are crossed with pea plants with the genotype Tlyy, ...

A: As per bartleby guidelines we are only suppose to answer one question kindly post the other one sepa...

Q: Partial Question 6 Which of the following are true about replisome components at the replication for...

A: During DNA replication, the replication fork is a structure that arises within the long helical DNA....

Q: What are the three big ideas of this chapter? Explainhow making the transition to more sustainable f...

A: "ANSWER  An estimated 1 billion people suffer from malnutrition. Modern industrial agriculture harm...

Q: PART I. THE THEORY OF EVOLUTION. DIRECTIONS: Complete the paragraph about evidence of evolution by c...

A: Introduction :- The theory of evolution is founded on the assumption that all species are connected ...

Q: If you saw a red afterimage of flag stripes after staring a green-striped flag for a long-time, it i...

A: The term vision is associated with the living beings’ ability to detect the difference between diffe...

Q: Two distinct species of organisms breed and create a hybrid. The hybrid was the result of nondisjunc...

A: Autodiploidic : condition where cell has two or more copies of single haploid set of a condition in ...

Q: For an In vitro mimicking infection test:

A: Introduction: Cell culture is the process of growing cells in a controlled setting, usually outside ...

Q: When you flush your toilet, where does the wastewater go? Trace the actual flow of this water in you...

A: The wastewater treatment plant is an important part of the community. It helps ensure that the waste...

Q: 60. When a white eye Drosophila male (X' Y) is crossed to a red eye female (X* X"), in the F2 genera...

A: Eye color in Drosophila: it is a X-linked trait. Red eye trait is dominant trait while other eye col...

Q: What is the shape of the following cells?       spirochete     cocci     spirillum     baci...

A: INTRODUCTION The shape of the bacteria in the picture is given below.

Q: is nature an art?

A: Nature- It is the physical world or universe or anything around us. No, Nature is not an art because...

Q: Explain which type of isolating mechanism this would be once you determine the barrier type?

A: Isolating mechanisms are the processes by which groups of organisms become isolated long enough to g...

Q: O 19% O Cannot determine O 62% O 38% O 31% OoooO

A: According to the chargaff's rule, we know that the purine bases and pyridine bases are present in ra...

Q: Given the below information, what is the narrow-sense heritability for this trait? VA 0.22 Vp 0.75 V...

A: The narrow-sense heritability is the ratio of additive genetic variance(VA) to total phenotypic vari...

Q: For a simulated population in AlleleA1 to be in Hardy-Weinberg equilibrium, the mutation rate would ...

A: The physical traits or appearance of an organism are referred to as its phenotype. The genotypes, or...

Q: 1. In addition to the ABO blood group, many others have been identified in humans. One such group is...

A: MN blood group is under control of an autosomal locus . This blood group has two alleles LM and LN t...

Q: Continuing his experiments, in Miles Morales' genome, the Goblin found similar genes, including one ...

A: In the given case, let the allele associated with invisibility be “I” and allele associated with agi...

Q: Rabbits may be classified as agouti, chinchilla, Himalayan, or albino according to coat color. A cro...

A: Rabbits may be classified as agouti, chinchilla, Himalayan, or albino according to coat color  We kn...

Q: Explain how a pigment absorbs light

A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...

Q: 4. Distinguish among the three processes of genetic recombination in prokaryotes: a) transformation,...

A: Distinguish among the three processes of genetic recombination in prokaryotes: a) Transformation, th...

Q: make a pictogram showing the evolution of wheat.

A: The evolution of wheat Wheat is a grass that is commonly farmed for its seed, a cereal grain that is...

Q: Question 4 Which one of the following mutations would cause a shift in the reading frame? O Deletion...

A: Sol: Mutations: These are the alteration or change in the sequence of genetic material of the organi...

Q: 1. Why do we pass the smear in the open flame of the bunsen burner 3 times? What do we want to achie...

A: 1.sampling usually have the following stages to identify the bacteria. Staining smear preparation H...

Q: Explain The Discovery of CRISPR ?

A: The common technology   that can be used to edit genes is refers as the CRISPR. In other words you c...

Q: What are crRNA biogenesis ?

A: Introduction: DNA editing systems in bacteria were the basis for CRISPR-Cas9. CRISPR arrays are DNA ...

Q: I. Apply your knowledge on the basic structure of amino acids by creating a polypeptide chain that i...

A: The amino acids are the basic structural unit of proteins that contain an alpha carbon which contain...

Q: Reproductive modes can be defined based on energetic provisioning (lechithotrophy vs. matritrophy) o...

A: Based on the mode of reproduction , animals can be classified. Based on the type of partition (parit...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: Describe how energy and matter flow,interact, and change forms throughout the Earth System.

A: *Energy and matter cannot be created or destroyed.They can change forms  * As energy flow through it...

Q: 1. Is a microscope an absolute necessity for studying microorganisms? Why or why not? 2. What do you...

A: 1:-Naked eyes have limitations to see object, they can't see the object having size less than 100mic...

Q: MicroRNAs attach to mRNA. In doing this, they... O Lead to the production of more protein O Lead to ...

A:

Q: Motor neurons innervating the digits are derived from spinal cord segment________, and then under go...

A: Answer :- Motor neurons innervating the digits are derived from spinal cord segment of muscles and g...

Q: In what direction is there a net movement of particles along their concentration gradient? Would you...

A: Diffusion is the movement of substances in a passive way.  

Q: What led researchers to conclude that a repressor moleculeregulates the lac operon?

A: Lac operon is regulated by the lac repressor molecule.