Once a healthy biological male has reached adulthood, do his cells continue to divide by both mitosis and meiosis? Outline when each type of cell division might occur.
Q: DNA, which is negatively charged, can adsorb onto the surface of citrate-capped Au nanoparticles.…
A: Langmuir adsorption isotherm describes the situation of equilibrium between the two systems…
Q: Mutants were isolated in which the constitutive phenotype of a missense lacl mutation was…
A: In an experiment, the mutants were isolated in which the constitutive phenotype of a missense lacI…
Q: explain how algal bloom occur and discuss its effect on the aquatic environment and species
A: The aquatic ecosystem contain different organisms, some of which are phototrophic and some others…
Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…
A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…
Q: How many different DNA sequences could code for amino acid sequence Met-His-Leu-Thr-Trp-Lys? (Note:…
A: DNA is a hereditary molecule. It carries the genetic information that is passed from one generation…
Q: During your experiment you analysed only a few of the recombinant clones for the presence of the…
A: A Genomic library consists of the total genomic DNA of an organism. This DNA can be stored inside…
Q: The following DNA sequence is found on a chromosome in rice plants: 5’…
A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…
Q: II. Questions for Research. 1. What are the adult derivatives of the pharyngeal pouches? 2. What is…
A: A research question is a question that a researcher asks in order to collect data that will help…
Q: ㅁㅇ PTO 어어어어어어어 In the pedigree shown, indicate whether each of the following inheritance patterns is…
A: Some genetic abnormalities have an inheritance pattern known as autosomal recessive. A gene is…
Q: Mr. Grady, a 70-year-old male with a history of arthritis, is evaluated by his rheumatologist for a…
A: The inflammatory arthritis known as gout is characterized by recurring outbreaks of red, painful,…
Q: C. In a horse population, three different traits showing continuous distribution were measured, and…
A: A measure called heritability is used in breeding and genetics to determine how much phenotypic…
Q: 10.0 8.0 6.0 5.0 4.0 3.0 2.0 1.5 1.0 0.5 MC 179 196 198 210 222 234 253 254 M נות
A: To pinpoint a specific gene's location on a chromosome, geneticists employ maps. In one kind of map,…
Q: Does DNA alterations during DNA replication result in the formation of cancerous cells? And how does…
A: DNA is the deoxyribonucleic acid, which contains the genes in the form of a sequence of nucleotides,…
Q: mul with to lower water A normal red blood cell is small and shaped like a flattened disk. The…
A: The plasma membrane of the cells including RBC perform as a semipermeable membrane. We know that…
Q: Describe the lac operon
A: Lac operon, this concept was proposed by Jacob and Monod in 1965. An operon is a functioning unit of…
Q: In eukaryotes there is not a consistent relationship between the length of the coding sequence of a…
A: DNA is 2.2 m long molecule in human beings. It is converted to mRNA via process of transcription.…
Q: In this cartoon, imagine that Romeo is a potassium ion (K+) and Juliet is a sodium ion (Na+).…
A: The plasma membrane of the cell regulates the entry and exit of different molecules according to…
Q: Plant breeders have long appreciated the phenomenon called hybrid vigor or heterosis, in which…
A: Cytoplasmic male sterility (CMS) in corn is caused by defective mitochondrial genomes that impede…
Q: Which of the following embryological events is involved in the formation of the ovarian follicles?…
A: Ovarian follicles are fluid filled follicles present in ovaries which remains in first meiotic stage…
Q: List the methods/techniques used to enhance drug solubility and briefly describe each.
A: Introduction Solubility, the phenomenon of dissolving a solute in a solvent to produce a…
Q: The movement of glucose across the plasma membrane is determined by: a. Electrochemical gradient O…
A: Plasma membrane is the selectively permeable membrane, which allows the movement of only selective…
Q: Jon performed a pour plate technique to determine the concentration of viable cells in her mother…
A: INTRODUCTION Pour plate technique This technique helps in enumerating bacterial cells in a mixed…
Q: You are studying a newly discovered gene, whose alleles code for one of two phenotypes, either…
A: Inheritance pattern is a type of pattern which determines how traits are passed on from parental…
Q: Explain the target microbes/microorganism and mode of action of the antibiotic ofloxacin
A: A quinolone antibiotic called ofloxacin is effective in treating a variety of bacterial illnesses.…
Q: why do we use EcoRI plus HindIII rather than BamHI or Sau3AI?
A: Restriction enzymes are enzymes that cut DNA at specific recognition sites. These enzymes are used…
Q: Suppose a new mutation arises in a mitochondrial genome. Explain what would have to happen in order…
A: Mitochondria is a double membrain bound cell organelle found in eukaryotic cells. It contain double…
Q: explain what does hisatmine and adetycholine mimic. within smooth muscle receptors. what do they…
A: Histamine is an important chemical that has a role in a number of different bodily processes. It…
Q: Make or create one question about Speciation and ecology (Nature of species, reproductiva isolation,…
A: When a group within a species separates from other members of its species, it develops its own…
Q: Write down the functions of the following body system. Body System Functions 1. Skeletal System…
A: Introduction The human body has 11 distinct systems, collectively referred to as organ systems,…
Q: IV 1 = female - male 2 3 11 2 4 3 ? 4 C 2 5 5 3 4 6 6 The disease trait in this pedigree is…
A: Autosomal recessive is a pattern of inheritance in which two mutated genes are inherited from each…
Q: A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father…
A: Introduction Our biological parents pass on certain genetic traits to us. The term "X-linked…
Q: if the water potential of a dialysis is -4.0 and pressure potential was -2.0 and the solute is…
A: Introduction : The term "water potential" refers to the kinetic energy of water. When a solute is…
Q: According to the lab, tools are of value for a variety of reasons including____. a. providing access…
A: Prehistoric men have been using stone tools and this has been developed over millions of years.…
Q: 1 2 3 4 5 Electrons are freed. Glucose enters glycolysis. ATP is produced. Energy is invested to…
A: Every living cell in the body participates in the process of glycolysis. Ten enzyme-catalyzed…
Q: What is the lac operon?
A: The procedure of using a gene's data to generate a functioning genetic material is known as gene…
Q: Provide 2 examples of Diffusion, Osmosis, and Semi-Permeable Membrane (1 from the "Diffusion Through…
A: Diffusion and osmosis are quite similar which describes movement of substance from its a region of…
Q: mitochondrial genes affecting tRNAs. For example, one form of MELAS (mitochondrial myopathy,…
A: Mitochondrial diseases ( MELAS) are a heterogeneous group of rare genetic disease it is caused…
Q: Define Diffusion, Osmosis, and Semi-Permeable Membrane.
A: The premise that a cell is the basic building block of life underlies the study of cell biology,…
Q: The so-called hypervariable regions (HV1 and HV2) of the human mitochondrial genome are sometimes…
A: HV1 and HV2 are two hypervariable regions found in the human mitochondrial DNA (deoxyribonucleic…
Q: Hello, please read the attached Microbiology question and answer the question correctly. *If you…
A: Introduction KIA is known as Klinger's iron test. it is used to detect the carbohydrate…
Q: The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the…
A: Plasmid vectors are circular and extra chromosomal DNA which are capable of self-replication.…
Q: 13. What is the effect of the following in the DNA isolation process: affect isolation solution…
A: DNA isolation is a process through which the intact DNA of the organisms is extracted and used for…
Q: Haemophilia A is a severe coagulation disorder that shows X-linked recessive inheritance. Red-green…
A: Hemophilia is typically an inherited bleeding disorder where the blood does not clot properly. This…
Q: Assume the DpnI digestion has failed after the PCR in the synthesis of mutated plasmid by thermal…
A: DNA that has been methylated or hemimethylated is unique to Dpn I. The majority of E. coli strains'…
Q: One of the earliest stone tool industry is the____. This is a significant development in hominin…
A: The correct option is: d. Oldowan; led to the eventual dispersal of Australopithecus out of Africa
Q: how is scanning electron microscopy unique and usefulm what makes this so important?
A: Electron microscopes use a focused beam of electrons to image the specimen while optical microscopes…
Q: What are some affordances of visual mediums?
A: Visual mediums are of many types like digital and printed images, posters, photography, graphic…
Q: The genus Homo dates back to about____. a. 3.9 million years ago b. 1.8 million years ago c. 250,000…
A: At some point between 3.0 and 2.5 million years ago, the genus Homo first appeared . The Homo…
Q: During acclimatization to altitude, lowlanders develop which of the following? Metabolic acidosis…
A: Depending upon the pH level the body fluid could be acidic or alkaline. When pH is low, the…
Q: With which kind of antibiotic (static or cidal) would you expect the MIC and MBC to be about the…
A: Introduction : MIC is the minimum inhibitory concentration of the antimicrobial agents to inhibit or…
Once a healthy biological male has reached adulthood, do his cells continue to divide by both mitosis and meiosis? Outline when each type of cell division might occur.
In your answer, ensure you give details of:
the type of tissue which is produced by mitosis, and what can start this
process;
- the type of tissue which is produced by meiosis, what can start this process.
asap please
Step by step
Solved in 5 steps
- a. Explain how mitosis and meiosis are similar in their processes or mechanism using two examples. b. Explain how mitosis and meiosis are different in their processes or mechanism using two examples. **Please stay away from superficial statements such as both are a type of cell division. We are asking for a more detailed example based on how the cells proceed through the processes which has been highlighted in discussions, videos, and readings.What are the major differences between mitosis and meiosis? Explain this both in terms of the different steps of each event and with regards to the final products of each event. Remember to mention the events which are unique to meiosis and why they are significant.A Diagrammatic Comparison of Mitosis and Meiosis Name: Draw chromosomes in the following cells to represent the various stages of mitosis and meiosis for an organism with a diploid number of 4. Label your diagrams with descriptions of the chromosomes and the key events that are occurring during this stage of the process. Mitosis Interphase Prophase Metaphase Anaphase Telophase OOO
- This cell is in (phase?) of (Mitosis / Meiosis 2 / Meiosis 1)?Meiosis occurs in the development of 1 point sex cells. Mitosis occurs in most other cells. Identify one additional difference between these processes. * Your answerState 3 important results of meiosis. For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). TTT Arial ✓ 3 (12pt) ✓ T-E One parent cell undergoes mitosis, which results in the division of two identical daughter cells. Definition of primal Mitosis is the mechanism of reproduction in unicellular eukaryotes. For eukaryotes with many cells: Mitosis boosts cell production and promotes bodily growth and development.Damaged tissues or organs can be repaired by mitosis.Mitosis is a kind of reproduction for vegetative organisms that results in offspring with the same genotype as the parent.
- Explain the three main differences between mitosis and meiosis. Be sure to include where they take place and the resulting cells.Oogenesis is the process of female gamete (ovum or egg) production in animals. Spermatogenesis is the process of male gamete (sperm) production in animals. Although both processes produce gamete(s), there are distinct similarities and differences between the two. Compare and contrast oogenesis to spermatogenesis by drawing a diagram showing the two processes. In your hand-drawn diagrams, be sure to include when the processes of mitosis, meiosis I and meiosis II are occurring identify each germ cell structure and its ploidy highlight 4 differences between the two processesPlease briefly describe the steps of MITOSIS here using diagrams, illustrations, and information from the internet or your text to help with your description..…include in your discussion the steps: Interphase; Prophase; Metaphase; Anaphase; and Telophase where needed
- A diploid cell has 4C genetic material and 16 chromosomes at the start of cell division. Identify number of set/s of chromosomes per cell after mitosis, number of set/s of chromosomes at Telophase 1, and number of chromosomes per cell at Telophase 1.A cell in G1 of interphase has 8 chromosomes. How many chromosomes and how many DNA molecules will be found per cell as this cell progresses through the following stages: G2, metaphase of mitosis, anaphase of mitosis, after cytokinesis in mitosis, metaphase I of meiosis, metaphase II of meiosis, and after cytokinesis of meiosis II?Which of the following is/are true of MITOSIS but NOT MEIOSIS? (May select multiple answers.) O Results in two identical diploid cells. Involves one round of cell division. Involves one round of DNA replication. O Results in four different haploid cells. O Involves two rounds of DNA replication O Involves two rounds of cell division A process required for multicellular organisms to grow bigger. O A process that results in haploid gametes.