O The recommended quantity of dietary fiber is 11.5 g/1000 calorie.

Q: 33 32 10

A: Respiratory system is a part of body system which is generally involved in exchange of gases . In…

Q: CN12 Hypoglossal

A: The twelve pairs of nerves that arise from the brain and function to connect the brain with several…

Q: D O Thomson Higher Education Which letter indicates the site of filtration? A O B Oc O D O E

A: The kidney is the versatile organ responsible for excretion. It has further distinct minute…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: stroke & Normal pregnacy( antenatal monitoring)

A: Stroke is a medical condition that occurs when the blood supply to part of the brain is interrupted…

Q: Use the measurement tool to measure the zone of inhibition for each antibiotic sample in millimeters…

A: Antibiotic zone of inhibitionAntibiotics are the compounds or substances that kill or inhibit the…

Q: Body symmetry: Drawing of organism: #5 Distinctive features: Domain: but ri to consider that all…

A: Sponges are multicellular organisms that are studied under spongiology. They are heterotrophic…

Q: more?

A: Introduction :- Reflexes are innate, automatic, and rapid responses to specific stimuli that occur…

Q: Aphakia and it's correction

A: Eye- The eye is one of the sense organs of the body which is used for seeing different objects. The…

Q: 3 - 2 WWW 36594 Your け 5

A: This is the saggital section of head and neck. Various labelled structures seen are as under…

Q: tbi - brain

A: A traumatic brain injury is a brain injury that occurs suddenly. When the head is hit, bumped, or…

Q: FAILURE TO THRIVE

A: Failure to thrive is a descriptive term and is not actually a diagnostic term. This term is used…

Q: dysthanasia pros and cons

A: Dysthanasia is the prolongation of a person's biological life using artificial means. Without…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: Where did you answer the last 2 questions?

A: 5'UTR stands for untranslated region at the 5' end of the DNA sequence. 3' UTR stands for…

Q: 7

A: The urinary system is responsible for the production, storage, and excretion of urine. Urine is…

Q: Dog

A: Animal are the organism which consists of sub unit of animal cell. The cell wall is not found in…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: DISBAILITY

A: Disability refers to a physical, sensory, cognitive, or mental condition that significantly impairs…

Q: Title: Girl interrupted Director: James mangold Assessment (seen in the movie)

A: Girl interrupted is an American psychological drama movie directed by James Mangold in the year…

Q: Mary O'Keefe calls the Inner City Health Care office in a panic. Gwen Carr, CMA (AAMA), answers the…

A: Electrocution is defined as death that occurs mainly by electric shock, either deliberate or…

Q: Can you help me identify the white box locations?

A: The cardiovascular system is an organ system which distributes blood to all the parts of the body…

Q: Name plz

A: Answer. The digestive system involves the gastrointestinal tract and the accessory digestive organs.…

Q: engetics

A: The study of energy transfer within the living things is energetics and explain how energy flows in…

Q: What about the references?

A: If we see around us there so much there to explore and learn. Science allows us to understand things…

Q: What is  hypoventilation

A: Ventilation is a process of exchange or movement of air (gas) between the lungs and atmosphere…

Q: Definition of IP3

A: Cell signaling is the process of communication between cells. It occurs with the help of various…

Q: Which letter represents the corpus spongiosum? -B -D OD O A CDE

A: Introduction: The male reproductive system comprises the following: A pair of testis Accessory…

Q: is

A: The body part shown in the figure is the lower limb. Lower limbs is the anatomical term given to the…

Q: 7nm= _ um= _ mm

A: 1 nano meter is equal to 0.001 or 1/1000 micrometer 1 micrometer is equal to 0.001 or 1/1000 milli…

Q: did Dr. Sergio Canavero exceed medical innivation with his head transplant?

A: Dr. Sergio Canavero of the Turin Advanced Neuromodulation Group (TANG) in Italy announced his…

Q: Would nlap it was exposed to a chemical that blocked its voltage-gated sodium channels so that they…

A: Membrane potential : It is a potential gradient that forces ions to passively move in one direction.…

Q: Can you do the first part

A:

Reproductive system infection

The biological process through which parents produce new children is called reproduction. A reproductive system is a group of internal and external organs that collaborate to allow males and females to reproduce. Many experts believe that the reproductive system is one of the most important systems in the body due to its crucial function in the survival of the species. Among the body's basic systems, the reproductive tract is the one that differs the most between sexes, and it is also the only one that does not operate until puberty.