Q: What is the following specimen? Our invertebrate zoology professor told us there is a bryozoan on…
A: It is a Bryozoa which is commonly called as Moss animal, they are also called as Ectoprocta and…
Q: What is the adaptive value of a fixed action pattern in animal behavior?
A: Innate behavior is behavior that is genetically programmed into an organism's DNA and can be…
Q: Which plant cell have unevenly thickened cell walls which provide flexible support for the growing…
A: The peripheral part of the cortex frequently contains collenchyma. Collenchyma is a supporting…
Q: Compare and contrast the three main types of exploitativespecies interactions. How do predation,…
A: The population of different species present in a community interacts with each other and with…
Q: Which of these are known to host chemosynthetic communities? a) Hydrothermal vent O b) Hydrocarbon…
A: The food chain in our ecosystem depends on the primary producers as they are capable of harvesting…
Q: In your point of view as a senior high school stem student, is it important that we should be…
A: The prevalence of hypertension was 37.3%, and the prevalence of pre-hypertension was 46.4%. 49.7% of…
Q: Sino-atrial node is called the pacemaker of our heart. Why?
A: Introduction In this question we will discuss why Sino-atrial node is called the pacemaker of our…
Q: cholerae, disrupt G Protein Coupled Receptor (GPCR) signaling pathways. They interfere with... the…
A: GPCR is a family of cell surface receptors that perform its action mainly through the action of GTP…
Q: 5. What type of diversity refers to all the different genes contained within all members of a…
A: INTRODUCTION Answer of question number 5 is given below.
Q: What are the assumptions made during the calculation of net gain of ATP?
A: Several assumptions are made in order to perform theoretical calculations on ATP molecules, the most…
Q: Explain and distinguish between a hypothesis and a scientific theory as well as distinguish between…
A: A hypothesis is just an imagination that is not supported by any data. The hypothesis is also called…
Q: The first cells were probably (a) photosynthetic (b) aerobes (c) anaerobes (d) a and b (e) a and c
A: The first photosynthetic bacteria appeared about 2 billion years ago and they are able to produce…
Q: You are in your kitchen looking out of the window watching a group of people 100 m in the distance.…
A: The retina is the photosensitive layer in eyes that contain rod and cone cells. If light exposed on…
Q: Why are food chains relatively short? O Not enough energy is transferred from one trophic level to…
A: Food chain is defined as the series of organisms on which one organism feeds on below level…
Q: how does the location and abundance of regulatory DNA sequences change with increasing organism…
A: Promoters, enhancers, and silencers are the three main types of regulatory sequences.
Q: Why do we consider blood as a connective tissue?
A: Connective tissues have cells scattered all over the extracellular matrix.
Q: During the isovolumetric periods there is no change in volume.
A: Isometric contraction or isovolumetric period is an event that occurs in the early stages of…
Q: Explain the answer using the concepts of protein inside the microorganisms cell wall etc
A: Disinfection is a process in which the micro organisms are reduced through the disinfectants on…
Q: Many scientists think that _______________ was the first information molecule to evolve. (a) DNA (b)…
A: The Earth has formed 4.6 billion years ago from the sun as a result of the constant bombardment of…
Q: Pick four of the following homeostatic imbalances of the digestive system and describe what is…
A: Homeostasis is a condition where individual maintains it's body's stability according to the…
Q: Where did eukaryotes come from?
A: Introduction The origin of life on earth can be traced back to 3.4 billion years ago and as we now…
Q: Which among the following is NOT a characteristic of Angiosperms? Read and analyze the question and…
A: A flower, at times known as a bloom, is the conceptive design found in flowering plants. The…
Q: Competitive exclusion is rarely observed in ecosystems. Propose an explanation for this.
A: An ecosystem is a community of different species of living organisms and their physical environment.…
Q: Question 5. You are interpreting data on a DNA chip, or microarray. You expose the chip to a mixture…
A: A microarray is a collection of probes or oligos attached to a chip. Microarray is employed to…
Q: Why are food chains relatively short? O Not enough energy is transferred from one trophic level to…
A: A food chain can be defined as the relationship between constituents of one trophic level and…
Q: State the volume of air remaining in the lungs after a normal breathing.
A: Introduction In this question we have to state the volume of air remaining in the lungs after a…
Q: Mapping is the bioinformatics term used to describe alignment of sequence reads to a reference…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Explain the following statement in 4-6 lines 1. Premalignant (hyperplastic or dysplastic) cells…
A: Cancer is an uncontrollable growth of cell. Cell multiply by the process know as cell division, by…
Q: The beautiful red postman butterfly (Heliconius erato), shown below, has 21 pairs of homologous…
A: The gametogenesis is the process of formation of gametes. This gametes are formed on the basis of…
Q: importance of plasma proteins
A: Plasma proteins These are blood proteins or the proteins present in the bloodstream. They are of…
Q: What is the importance of plasma proteins?
A: Definition- Mixture of simple proteins, glycoproteins, , lipoprotein are present in the plasma of…
Q: What is the significance of step-wise release of energy in respiration?
A: Introduction In this question we will discuss about the significance of step-wise release of energy…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Hello sir, can you summarize, I mean, a short solution, not long?
A: Organ system The human body is designed to perform multitasks and these cannot be done by a single…
Q: Evaluate, using examples from the past, how organisms might or might not be expected to adapt to…
A: Long-term changes in temperature and weather systems are referred to as climate change. Although…
Q: Posterior 5. Dorsal 6. Ventral
A: The standard body “map,” or anatomical position, is that of the body standing upright, with the feet…
Q: (A) Mean water absorption rate and (B) mean percentage of time spent in the water absorption…
A: Fully hydrated toads, Bufo bufo were acclimated to a simulated terrestrial habitat, with access to…
Q: The syndrome of inappropriate secretion of antidiuretic hormone (SIADH) is a disorder of impaired…
A: Primary polydipsia maybe because of harm to the thirst-regulating mechanism within the hypothalamus.…
Q: A pacemaker is a small device that is placed in the chest or abdominal help control abnormal heart…
A: Introduction A pacemaker is a small, battery-operated device used to control an irregular heart…
Q: 1. Recombinant DNA technology products are now used in various fields, some in agriculture, while…
A: Recombinant DNA technology It refers to the combining of DNA molecules from two distinct species.…
Q: When the second ATP is regenerated from ADP during the contraction cycle, what happens? 1.myosin…
A: * Muscle contraction occurs when thin actin and thick myosin filaments slides each other which is…
Q: Question 9. What basal transcription factors can only bind to the DNA within the pre-replication…
A: The basal transcription factor TBP binds to the TATA box, a DNA sequence found within many, but by…
Q: how would you convince a person about the validity of evolution in taxonomy?
A: Introduction Evolution is the biological change in the characteristics of a species over a span of…
Q: What would happen to the ATP yield of cellular respiration if: The inner membrane of the…
A: The cellular respiration involves breakdown of glucose and production of energy in the form of ATP.…
Q: Describe in detail the involvement of Cysteine Proteases within the Life cycle of a Malaria…
A: In the life cycle of Plasmodium, changes between developmental stages can be considered crucial.…
Q: My mother who is a type 2 diabetes mellitus patient is taking empagliflozin, a SGLT2 inhibitor, for…
A: SGLT2 which stands for Sodium-glucose co-transporter-2 (SGLT2). It is a anti hyperglycemic drug.
Q: Write a unique prediction about a factor that could increase alcohol fermentation
A: *Alcohol fermentation is also called as Ethanol fermentation which is a biological process that…
Q: Underline the error in each of the following statements and provide the correction. ii. Smooth…
A: Introduction Smooth muscles are involuntary muscles i.e. these muscles are not under conscious…
Q: What are the advantages and disadvantages of having a Moist, permeable skin in amphibians?
A: ANSWER;- advantages;- Most amphibians have thin skin that is very permeable (allowing fluids and…
Q: Describe the basic principles of the theory of evolution by naturalselection.
A: Darwin's Theory of Evolution is called natural selection and it is based on some basic concepts that…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps