Most migrants to the United States during the eighteenth, nineteenth and early twentieth century came from which region? 1) Australia 2) Latin America 3) Africa 4) Europe 5) East Asia (China, Japan, the Koreas, Taiwan, etc.)

Q: What types of sedimentary rocks would have formed in Alabama in the Late Cretaceous? Beringia…

A: Answer:  The Correct answer would be option C, Shallow marine sediments like sandstone.   Detailed…

Q: Using the image below, where does the 2015 channel and that from 1990 deviate the most? Why did the…

A: Meander is the sinuous curves in the river channel. A meander forms when river or stream cuts…

Q: Jupiter Sun figure above shows the orbits of two comets as they g nd the Sun. The orbit of Comet A…

A: INTRODUCTION  WHAT ARE COMET, JUPITER, AND SUN COMET: An object in space that looks like a bright…

Q: PI 0 Abrasion 100% Stone Mountaip Granite 20 40 Av. Appalachian Grantes (Basu) Panola Adamellite 60…

A: A ternary phase diagram illustrates potential phases and their equilibria for a mixture of three…

Q: Of the list of terms and phrases below, select the ones that describe either formation areas or…

A: A growing mid-latitude cyclone's warm sector The region between the primary warm front and the…

Q: studies have shown that the greater the heterogeneity (i.e., patchin community, the greater the:…

A: Answer) According to Heterogeneity hypothesis theory it is given that, as the habitat heterogeneity…

Q: MULTIPLE CHOICE Which of the following factors affect the rate of weathering in an area? Select all…

A: Geomorphology is the field of earth science which aims at studying all the physical components that…

Q: What is the driving force behind ocean currents, and is that force the same different depths?

A: Ocean current is primarily movement of ocean water under the influence of various natural phenomena.…

Q: f(t) = { -cost, cost, T ·<t <0; 2 0<t≤ a) Plot the function f(t) on the interval -27≤t≤2π. b)…

A:

Q: Think of a topic of interest to you within the subject of Earth and Space Science. How might the…

A: Palaeontology is a subject of Earth and Space Science which is solely learning about fossils of…

Q: Question 2 List the following for the Himalayas: What type of plate boundary is this What types of…

A: Divergent, convergent, and transform plate boundaries are the three different types of plate…

Q: Describe the characteristics of karst topography and what features might indicate that karst is…

A: Karst Topography is the formation of landforms due to solution and deposition on any limestone or…

Q: If a space probe is sent into an orbit around the Sun that brings it as close as 0.4 AU and as far…

A: Option B. The orbit is an ellipse. The period is 4.9 years.

Q: Saturn has a mass of 5.86x1026 kg and the sun has a mass of 2.00x1030 kg. Some orbital locations are…

A:

Q: In an article published by the New York Times, it is stated that Stalin "used propaganda to create a…

A: Joseph Vissarionovich Stalin was a Russian political figure and Georgian communist who headed the…

Q: Which type of wave below correspond to the elastic behavior where the atoms in the rock compress and…

A: A seismic wave is an acoustic wave of energy that travels through the Earth and is generated because…

Q: P9.1 The longitude of a location is 93°W and the standard longitude of the time zone is 90°W. The…

A: When the sun is facing east and 180 degrees south, the azimuth angle is 90 degrees.

Q: If the organism die due to the heating, why does the third setup have microbial growth?

A: Warmth, dampness, pH levels and oxygen levels are the four major physical and synthetic variables…

Q: Which major city's water resources are mainly from local and shallow aquifers? Paris, France New…

A: Moscow Russia: Water Resources:  Moscow is considered as one of the city located in Russia has the…

Q: Descobea nature boog, stets and epith the proses by whicha natura intre tons, and is the other…

A:

Q: Which of the following statement is false? O Tidal flats are formed from the fine-grained sediments…

A: Ans:Option C *Tidal flats are places where mud or sand are left behind by tides or runoff from…

Q: How an ordinary citizen like you can contribute to fighting climate change?

A: 1.According to Ben Strauss, chief scientist of Climate Central, a company that focuses on climate…

Q: When baking soda (NaHCO3) and vinegar (HC₂H302) react, one of the products is carbonic acid (H₂CO3).…

A: Answer: Temperature changes are caused by quantities of water vapour and carbon dioxide.   In…

Q: #2 TACCCCTCTAATGACAGTACT TRANSCRIPTION mRNA: Protein (amino acid sequence): TRANSLATION

A: The RNA TO mRNA follow this sequence A to U. C to G. T to A.

Q: which of the following is believed to be a cause of climate changes over the last 1,000 years…

A: Introduction Climate change is a major topic of discussion right now due to its increased impacts on…

Q: In Lab 7, Classification of Stellar Spectra, what was the sequence of the Stellar Classifications…

A: Introduction Most of the classifications in this regard is done using Morgan Keenan system i.e. it…

Q: Rocks in the lower crust and upper mantle are O liquid O a mixture of liquid and solid O solid and…

A: There are two main layers of the crust: SIMA AND SIAL. SIMA is the lower layer of the Earth's crust…

Q: name of that bug?

A: Solution

Q: In the early 1950's, Stanley Miller and Harold Urey conducted a series of pioneering laboratory…

A: Introduction Miller and Urey's experiment won NObel prize and it found out that the Earth's…

Q: 2. (11 s) Refer to Figure 1, which shows a body of rock from visual (outcrop) to thin section…

A: The depositional energy may able to sperate the different grains based on the speed of the erosion…

Q: Ice sheet is another name for mountain glaciers. O True O False

A: The ice may be stores in continental glaciers and mountain glaciers. The mountain glaciers may exist…

Q: Volcanoes Essay Assignment What did you think of the Volcanoes: Natures' ticking time bomb story? Be…

A:

Q: A periodic function f(t) of period 2 is defined by 3t (0<t<1) (1 < t <2) f(t) = 4 f(t + 2) = f(t)…

A:

Q: Question 50 Where can one find large quantities of loess in the Midwestern United States? The Black…

A: Loess Hills of the United States: Loess is a wind deposited slit that are composed in the top most…

Q: 19 () In the space below sketch the visible reflectance spectra of a carbonaceous chondrite parent…

A: Most carbonaceous chondrites are assumed to be produced from low-albedo, C-type asteroids, which are…

Q: Exercises 0+40 1. Given the following survey data, calculate the ATVD, ANorth and AEast using the…

A:

Q: The correct equation for photosynthesis is: carbon dioxide + water + sunlight → glucose + oxygen…

A: Answer) Photosynthesis is the process in which green plants use atmospheric carbon dioxide in…

Q: Consumer-resource "mismatching" can occur via shifts in: a. seasonality b. altitude c. body size e.…

A: Consumer is the final destination of a product and resource is the source or origin of that…

Q: The IADC classification system for PDC bits and roller cone bits are the same. Also, The IADC dull…

A: Drillers can more easily define the type of rock bit they are seeking for to the supplier using IADC…

Q: describe the variable contributing area concept using examples at multiple spatial scales

A: Answer:   The basic idea of the variable source area of streamflow and storm-flow production…

Q: are the most numerous organisms on Earth. Chemolithotrophs Extremophiles Prokaryotes Eukaryotes

A: Chemoheterotroph are described as rock eaters. They generally use the inorganic reduce element as…

Q: Question 2 Volcanic activity during Earth's formation is responsible for contributing a significant…

A: Carbon dioxide and water vapor are great greenhouse gases. These gases trap long-wave terrestrial…

Q: Question 1 Which of the following is NOT a criteria used to determine whether a substance is a…

A: Minerals are defined as the natural substances with definite crystal form, orderly internal…

Q: The photospheres of red giant stars have the same temperature as those of red dwarf stars. However,…

A: Option A Red giants have a much larger radius, and luminosity depends on both temperature and…

Q: 1. Measure the angular size of the Moon. 2. Calculate the size of the Moon using the distance…

A: 1. The angular size = A. Formula for that is (A/360) = (diameter of objects/ 2π*distance between…

Q: O olivine, calcium-rich plagioclase feldspar, pyroxene, amphibole, biotite, potassium feldspar,…

A: Bowen’s Reaction Series provides us the normal order of crystallization of minerals from a melt as…

Q: Which of the following is NOT an advantage of bilateralism? Leads to cephalization Associated with…

A: Bilateralism is defined as the bilateral symmetry. It is an imaginary plane which devide the body or…

Q: In the above figure, letter "B" can best be identified as: Oan ox-bow lake O a reservoir O a…

A: The river has three stages. Those are young, mature, and old. The young stage has more weathering…

Q: When plates slide horizontally past each other, ­­­­­­­­­­­­­­­­­­__form in the brittle lithosphere.…

A: Fault: A fault is a fracture or zone of fractures between two pieces of rock with the relative…

Q: Make an Title tackling about the Biodiversity Loss and write Introduction, Body, and Conclusions…

A: Biodiversity loss involves both global extinctions of various species and local reductions or losses…