Millions of animals are lockedinside barren cages inlaboratories across countriesin Europe. Selected animalsare used for experiment todiscover antidote againstbacteria and viruses. Thisexperimentation is notallowed in other countries.Based on this information,which of the followingstatements is true?a. This is an example ofthe Common GoodApproach because itis based onconsequences ofactions is based onconsequences ofactionsO b. This is an example ofEthical Relativismbecause it meansthat ethics is stableand fixed betweenculturesO c. This is an example ofVirtue ethics becauseit is inherent forpeople to consideranimals much lessinferior to humansd. This is an example ofEthical Relativismbecause differentcountries havedifferent ethical viewsbased on norms andtraditions

Mice, rats, rabbits, and other animals are often locked inside a barren cadge in research labs. This…

Millions of animals are locked inside barren cages in laboratories across countries in Europe. Selected animals are used for experiment to discover antidote against bacteria and viruses. This experimentation is not allowed in other countries. Based on this information, which of the following statements is true?

Millions of animals are locked inside barren cages in laboratories across countries in Europe. Selected animals are used for experiment to discover antidote against bacteria and viruses. This experimentation is not allowed in other countries. Based on this information, which of the following statements is true?

Comprehensive Medical Assisting: Administrative and Clinical Competencies (MindTap Course List)

6th Edition

ISBN:9781305964792

Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Publisher:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Chapter37: Regulatory Guidelines For Safety And Quality In The Medical Laboratory

Section: Chapter Questions

Problem 3CR

See similar textbooks

Similar questions

Because of overuse of antibiotics and/or weakened governmental surveillance of infectious disease, several diseasesthat had been thought to be no longer a threat to humanhealth (e.g., pneumonia and tuberculosis) are rapidly becoming unmanageable. In several instances, so-called superbugs(microorganisms that are resistant to almost all known antibiotics) have been detected. How did this circumstancearise? What will happen if this process continues?
In a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 2,000, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 150. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? O Parasiticum mucoides O Both infections are equally likely Donoteatum thisbacterium There is no way to know given the information provided MacBook Air DD F9 80 000 000 F8 F7 F6 F5 F4 F3 *
Your patient has a severe sore throat. A throat swab has allowed you to isolate the causative bacterium, which you subjected to a Minimum Inhibitory Concentration Test. For each of the antibiotics tested, you also know its therapeutic index. Whích would be the best drug to use to treat your patient? O Highest MIC and largest therapeutic index O Lowest MIC and smallest therapeutic index O Highest MIC and smallest therapeutic index O Lowest MIC and largest therapeutic index
This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids
Considerthefollowingscenarioandanswerthequestionsthatfollow: Scenario:anaquaticsnailisplacedinatesttubefilledwithwaterand placedinasunnyenvironment. 1.Doesphotosynthesisoccur? 2.Doescellularrespirationoccur? 3.Willtheorganismliveordieifit remainsinthisenvironment? 4. Justify your answer to #3.
Clostridium difficile infection is the leading causeof hospital-associated gastrointestinal illness. It is typicallytreated with a course of antibiotics, but the infection recursin about 20% of cases. C. difficile infections are difficult toeradicate because the bacteria exist in two forms: a repli-cating, toxin-producing form and a spore form that is resis-tant to antibiotics. Fecal microbiota transplantation—thetransfer of normal gut microbiota from a healthy individ-ual—can resolve >90% of recurrent infections, a much bet-ter cure rate than further antibiotic treatment alone. Whydo you suppose microbiota transplantation is so effective?
The world is facing a Corona Virus (COVID-19) Pandemic and as a potential scientist and a microbiology student, you have been required to prepare the easiest and most affordable hand sanitizer that can be utilized by students in various microbiology laboratories. Each student in your class has been given 96% ethanol and you are required to prepare 70% ethanol hand sanitizer in a 2L spray bottle. Describe clearly the method you will use in order to achieve the aim of the practical.
Do you expect that an infectious pathogen suchas the bacterium Staphylococcus aureus or theHIV virus that causes AIDS will evolve to becomemore or less virulent? What do you need toknow in order to make your best projection? Youmay want to read about the biology of one suchpathogen in order to arrive at an answer.
When determining the clinical significance of cultures, a. the number of microbes is signifi cant. b. the presence of a single colony of a true pathogen may indicate the presence of the disease if the culture comes from a site known to be sterile (i.e., cerebrospinal fl uid). c. the repeated isolation of a relatively pure culture of any microorganism can mean it is an agent of disease, although this is not always the case. d. a range of tests may be needed to identify a pathogen. e. all of the above are true.
The following are the limitations of Koch's postulates EXCEPT: A. some pathogens cannot grow on artificial media and therefore cannot be identified as the causative agent of the disease B. some diseases involve multiple pathogens which produce similar symptoms making it difficult to pinpoint the causative agent C. some diseases are host-specific and re-inoculation may pose ethical concerns D. some microorganisms are present in the body fluids of the infected animal which make them difficult to be cultured
Suppose that the health department of city A mounts a suc-cessful campaign to get children immunized against measles.Only 100 out of 10,000 children fail to receive the vaccine. Nowsuppose that city B, the same size as city A, has not carried out asuccessful measles vaccination program. Of the 10,000 childrenin city B, 5,000 had measles when the disease last struck thepopulation.(a) If a child with measles moves to city A, what is thechance that child will encounter a susceptiblechild?(b) If a child with measles moves to city B, what isthe chance that child will encounter a susceptiblechild?(c) Comparing the two scenarios, which city has thehigher herd immunity, and in which city is aninfected child more likely to transmit the diseaseto a susceptible child?
My professor instructed me to make presentation on this topic "Periodontal microbes interaction with FISH". I have to make 4 power point slides regarding this topic. Can you give some information about the topic which i can use in the slides? Also provide some necessary relevant diagram or image regarding the topic. Please answer at your own easy words. If you do so i will rate you positive, Thank you.