Make a C++ program that creates a structure named WeeklyTemp. The struct should have 8 members: The name of the city and Daily temperature record (Monday-Sunday The program should give the average of daily temperature record. Sample output: Enter City: San Jose del Monte Enter temperature for Monday to Sunday 35.5 34.6 32.55 36.4 37.1 30.5 32.55 Average temperature in San Jose del Monte is: 34.1714

Make a C++ program that creates a structure named WeeklyTemp. The struct should have 8 members: The name of the city and Daily temperature record (Monday-Sunday The program should give the average of daily temperature record. Sample output: Enter City: San Jose del Monte Enter temperature for Monday to Sunday 35.5 34.6 32.55 36.4 37.1 30.5 32.55 Average temperature in San Jose del Monte is: 34.1714

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

c++ code Screenshot and output is must
Write Implicit and Explicit code blocks
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
C++ coding project just need some help getting the code thank you!
C++ and Python are required to achive the goal C++ source #include <Python.h> #include <iostream> #include <Windows.h> #include <cmath> #include <string> using namespace std; /* Description: To call this function, simply pass the function name in Python that you wish to call. Example: callProcedure("printsomething"); Output: Python will print on the screen: Hello from python! Return: None */ void CallProcedure(string pName) { char *procname = new char[pName.length() + 1]; std::strcpy(procname, pName.c_str()); Py_Initialize(); PyObject* my_module = PyImport_ImportModule("PythonCode"); PyErr_Print(); PyObject* my_function = PyObject_GetAttrString(my_module, procname); PyObject* my_result = PyObject_CallObject(my_function, NULL); Py_Finalize(); delete[] procname; } /* Description: To call this function, pass the name of the Python functino you wish to call and the string parameter you want to send Example: int x = callIntFunc("PrintMe","Test"); Output:…
C++ Nothing too advanced please. Learning the basics #include <iostream>using namespace std;int main()
c++ problem. paste indented code.
Assignment: Simplifying C Code Description: Reduce the C snippet on the next page to the most basic components possible, as discussed in the lecture. For instance, please try to eliminate the following language components, replacing them only with if/goto blocks: ● for loop while loop ●. switch statement . curly brackets { } (other than those surrounding main) += and -= notation Once complete, test your code and the original code with a few different initial values! Deliverables: Your simplified C code, in a plaintext (.txt) file A screenshot of the simplified code running, showing it produces the same output as the original. Using BF computer language.
C program, similar question from the book C how to program eighth edition question 4.14 but the problem add the -1
c++ problem. paste indented code here
Create a C++ Grocery Program according to this guideline: Linked List Functions Pointers Arrays The program must have a menu layout where the user can select certain action (Select Product, View My Cart, Check-Out, etc.) You must include all kinds of drinks/beverages Implement basic error tapping IYou must include the group name of the developers with the name of each developer (a total of 4) Group Name: In-Out Group Names: Cesar Rachel Jennifer Tom
C++ code. Please describe what EACH line means/does. Ignore code that is commented out.