LO11 Calculate the probability of genotypes and phenotypes in monohybrid crosses of sex linked traits What is the probability of a hemophiliac son if the mother is a carrier and the father is normal? Remember hemophilia is caused by a recessive X-linked allele. 2/3 3/4 1/2

Q: Question 5 of 10 Among the given statements, which one(s) is/are correct about alpha keratin? 1. It…

A: Alpha-keratin is a protein found in vertebrates. It is found in nails, hairs, claws and epidermis of…

Q: Chiral / achiral * HO. Achiral Chiral

A: Asked : If given carbon is chiral or not Given : CH3-CH2-CH(CH3)-CH2OH Marked carbon is to be…

Q: Name the class.

A: In a biological hierarchy, the class is a taxonomic level; that is, it is a taxonomic unit in that…

Q: Which of the following amino acids cannot be synthesized by the body? Select the correct…

A: Amino acids are the building blocks of proteins. Although, proteins are synthesized in the body, not…

Q: Adenine always pairs with

A:

Q: identify the question being asked   IUPAC name for C16:0

A: The IUPAC nomenclature of organic chemistry is a technique of naming organic chemical compounds that…

Q: Which is NOT an epimer of the monosaccharide below: CHO H- OH H- HO. CH,OH

A: An epimer is one of the two or more stereoisomers of the same molecule that differ in the position…

Q: How many chiral centers are present? CH,OH C=0 HO -H- Но- -H- H- -HO-

A:

Q: CH3 CI CH3

A: The given structure has functional group chlorine and two methyl groups are attached to side…

Q: List three important distinctions between fibrous and globular proteins.

A: Fibrous proteins and globular proteins are the two primary types of the protein's tertiary…

Q: 11 12. 13.

A: Hypogynous flower- This tye of flower is said to have inferior ovary that is all plant parts arise…

Q: Identify the highlighted structure

A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…

Q: 9) Label highlighted nerve in the box 10) This nerve belongs to the

A: The given diagram shows an image of the hip region and the highlighted nerve which exits from the…

Q: A B C (b) [Choose ] [Choose] [Choose ] <

A: The peripheral nervous system of the body consists of several nerves and ganglia, which play an…

Q: 4B. The hormones produced by this gland are: A

A: Pancreas is an organ that is located in the abdomen. Its major role is to conver the food intake…

Q: what are centrioles?

A: Centrioles are found in most of the eukaryotic  cells.  Centrioles are surrounded by pericentriolar…

Q: 11 Endocrine glands are often called "ductless glands" because their products are secreted directly…

A: Endocrine glands secrete hormones. Hormones are secreted from one gland and activates the functions…

Q: explain this figure

A: Amino acids are organic molecules that contain a basic amine group (-NH2) and a carboxyl group…

Q: Define beta (b) sheet

A: Proteins have different organization levels, which gives the properly folded functional form of the…

Q: What is centriole ?

A: Centrioles are paired barrel-shaped organelles located in the cytoplasm of the animal cells near the…

Q: 1. What is the possible identity of the amino acid? [ Select] V 2. What is the isoelectric point of…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…

Q: IDENTIFY THE FOLLOWING PARTS  A  B  C  D  E  F  G  H  I  J

A: The cell is the basic and functional unit of life. It is composed of various cell organelles.

Q: L--L--F--A--I--A--M--F--L--N--I--A--I--A--I What do you think will happen if large concentrations…

A: The given peptide is L--L--F--A--I--A--M--F--L--N--I--A--I--A--I.

Q: Spinal fluid contains 15 to 45 mg/dL protein. If you were to take a 5.0 mL sample of spinal fluid,…

A: Proteins present in spinal fluid is low in amount and small proteins as compared to blood serum.

Q: Anyone know these three Blood. Cells?

A: White blood cells (leukocytes) don't have a well-defined shape because their shape is continually…

Q: What is the K-T Boundary?

A: This boundary is a geological signature,  usually a thin band of rock. This boundary basically marks…

Q: Identify the amino acid(s) present in this structure. isoleucine Ophenylalanine valine cysteine…

A: The molecule in question is a dipeptide i.e. 2 amino acids joined together via a peptide bond. In a…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H. H,N-C-COOH…

A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: А C **.** F.

A: DNA(Deoxyribonucleic acid):- It is a hereditary material of all organisms present on the earth. It…

Q: Which structure is highlighted?

A: According to our guideline we can answer only the first question. So, upload the second image…

Q: The following lipids contain sphingosine as the alcohol backbone EXCEPT O Cerebroside O Ganglioside…

A: Sphingosine is composed of  an amino alcohol head group, with two hydroxyls, and one amino group…

Q: & 4

A: The forebrain is divided into a diencephalon as well as a telencephalon. The latter comprises two…

Q: 4. G's go with A's T's C's G's

A: Nucleic acid such as RNA or DNA is composed of several nucleotides joined end to end A nucleotide is…

Q: Which is NOT an epimer of the monosaccharide below: CHO H- H- HO- H- ČH,OH CHOICES:

A: Option CAT is not epimer of monosaccharide shown in the question.  Epimer: in which only one sugar…

Q: הנא (b) A section of DNA was analysed and 24% of its bases were found to be adenine. Calculate the…

A: DNA is a polynucleotide molecule made up of 4 types of nucleotides according to the nitrogen bases…

Q: Define allosteric effect

A: In human physiology, the term allosteric means change in shape or activity of a protein (majorly…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.