lease help me find the complete PYTHON CODE for this problem. Thank you! ASAP! Only the Even Ones by CodeChum Admin I have a list of 3 numbers here with me that's already in the code editor, but I want you to add some more to this list by inputting some more numbers yourself in one line and then, print out only the even numbers from the list. Can you do that for me?

lease help me find the complete PYTHON CODE for this problem. Thank you! ASAP! Only the Even Ones by CodeChum Admin I have a list of 3 numbers here with me that's already in the code editor, but I want you to add some more to this list by inputting some more numbers yourself in one line and then, print out only the even numbers from the list. Can you do that for me?

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter2: Problem Solving Using C++using

Section2.3: Data Types

Problem 5E

See similar textbooks

Only the Even Ones

by CodeChum Admin

I have a list of 3 numbers here with me that's already in the code editor, but I want you to add some more to this list by inputting some more numbers yourself in one line and then, print out only the even numbers from the list.

Can you do that for me?

Here is the list of 3 numbers in the code editor:

nums = [2, 3, 5]

Input

A line containing integers separated by a space.

33 54 32 11 8

Output

Multiple lines containing an integer.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Please help me find the correct PYTHON CODE for this problem. Thank you! ASAP! Only the Even Ones by CodeChum Admin I have a list of 3 numbers here with me that's already in the code editor, but I want you to add some more to this list by inputting some more numbers yourself in one line and then, print out only the even numbers from the list. Can you do that for me? Here is the list of 3 numbers in the code editor: nums = [2, 3, 5] Input A line containing integers separated by a space. 33 54 32 11 8 Output Multiple lines containing an integer. 2 54 32 8
please code in python You are probably familiar with the famous Fibonacci sequence of numbers, which begins like this: 1, 1, 2, 3, 5, 8, 13, 21... We'll index from 0, so the 0th and 1st numbers are both 1. The 2nd Fibonacci number is found by summing the 0th and 1st: 1 + 1 = 2. The 3rd is found by summing the 1st and 2nd: 1 + 2 = 3. After this point, each Fibonacci number is found by summing the previous two numbers. You are to write a recursive function to compute the nth Fibonacci number. This means that your function will call itself and will NOT include explicit loops. Hint: Your function should include a line that looks a lot like the mathematical definition of the nth Fibonacci number. Another Hint: It's possible for a recursive function to call itself more than once. Example: print(Fibonacci(1)) 1
please code in python """ TODOReturn whether the pattern was found or not (found), the number of times the pattern was found (n), all starting positions at which the pattern was found (positions) and the number of comparisons.""" Given text: CAGTCAGTCATCATGCGTATCAGCTGATC TATCGGGCGCGCGCGTATCATC Combinations to look for: TGCGTATCAGCTCGCGCG TATGTCA
its supposed to be written in python
i need the answer quickly
ddfergdr
ON PYTHON IDLE In this assignment you will write a program that shows the valid moves of chess pieces. Your program will draw a board with 64 squares using the traditional layout, next ask the user to choose a move, and then, depending on the user's choice, redraw the board with the selected chess piece and its valid moves. Please see the examples of valid moves of chess pieces and the traditional chess board layout below: At the beginning, your program should draw an empty chess board and prompt the user to enter a move: Welcome to the Chess Game! a b c d e f g h +---+---+---+---+---+---+---+---+8| | | | | | | | |8 +---+---+---+---+---+---+---+---+7| | | | | | | | |7 +---+---+---+---+---+---+---+---+6| | | | | | | | |6 +---+---+---+---+---+---+---+---+5| | | | | | | | |5 +---+---+---+---+---+---+---+---+4| | | | | | | | |4 +---+---+---+---+---+---+---+---+3| | | | | | | |…
in python, create a code that will allow you to read a dna sequence and give you the percentages of a, c, g, t, gc, and att's that come up in the sequence.
Please help me find the PYTHON CODE for this problem. ASAP! Thank you! Finding Letters by CodeChum Admin We've already counted digits before on a certain number, so how about doing it on strings and characters? There's a catch, though, since you're only going to count and see if the character exists at least twice in a string. Are you up for the challenge? Instructions Create two variables and assign them to an input() function. The first variable shall accept a single letter and the second variable shall store the inputted string. Using loops, count the number of times that the single letter appears on the inputted string, and when it appears at least twice in the string, print "Cody is really awesome"; else, print "Cody rocks".Tip: to make your code more efficient, use the break keyword to terminate the loop whenever the count of appearance of the single letter has already reached 2. Input The first line contains a single-letter string. The second line contains a…
Using the Python language answer the following questions below. Please tell me what program you use if it is IDLE or Atom or a python website please provide the website you use.
Please help find the PYTHON CODE to this problem. Asap! Thank you! Not my Favorites by CodeChum Admin We've already done looping through a series of numbers and printing out its squares, so how about we level it up and go with cubes this time? I have a condition though; I don't want to be associated with numbers that are divisible by 3 or 5 so if an integer is divisible by either of the two, don't make their cube values appear on the screen, please. Care to fulfill my request? Instructions: Print out the cube values of the numbers ranging from 1 to 1000 (inclusive). However, if the number is divisible by either 3 or 5, do not include them in printing and proceed with the next numbers. Tip: When skipping through special values, make use of the keyword continue and put them inside a conditional statement. Instructions Print out the cube values of the numbers ranging from 1 to 10 (inclusive). However, if the number is divisible by either 3 or 5, do not include them in…
ervsf