Q: In plants, the transition from water to land most likely happened once twice: ones in the moss linea...
A: The difficulties that the primary land plants needed to defeat going limp in land from gravity, the ...
Q: What is the importance of Gregor Mendel’s Law of Inheritance in Molecular Biology?
A: Gregor Johann Mendal(father of Genetics) published his results of hybridization experiments in a jou...
Q: Question 34 Carotenoids and chlorophyll would have two different absorbance spectra. O True O False ...
A: I gave you all the answer in Step 2
Q: Write a conclusion explaining the relationship between time and temperature
A: *The higher the temperature, more easily bacteria will grow to a certain point. *Very high and low...
Q: eta-lactam, aminoglycosides, polyenes, and quinolone antimicrobial agents on bacterial cells.
A: Antibiotics are antibacterial drugs. Antibiotic drugs are commonly used in the treatment and prevent...
Q: Individuals of genotype AaBb were mated to individuals of genotype aabb. One thousand offspring were...
A: Individuals of genotype AaBb were mated to individuals of genotype aabb. One thousand offspring were...
Q: The cell above is a lung cell of a salamander. In whichstage of mitosis is it? What are the structur...
A: A cell cycle is a series of processes taking place in a cell to grow and divide into two identical c...
Q: Describe the scope of human population growth
A: Population growth is the increased number of humans in the world. Most of the human history shows th...
Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with ...
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple...
Q: If a person reaches a BAC of 0.060% and then stops drinking, we would estimate that all alcohol woul...
A: Introduction :- Blood alcohol levels are decided by the blood alcohol concentration calculator . It ...
Q: Which structure is highlighted? Multiple Choice saphenous nerve obturator nerve sciatic nerve and br...
A: Introduction Saphenous nerve:- it is the largest branch of the femoral nerve and innervates the medi...
Q: Match each stage with the events listed. ___ metaphase a. sister chromatids move ap...
A: Metaphase is referred to as a stage where there is a condensation of chromosomes occurs. In prophase...
Q: Explain comprehensively. a. How does evolution play a role in meiosis and sexual reproduction? b....
A:
Q: _____ are characteristic of cancer. a. Malignant cells b. Neoplasms c. Tumors
A: Introduction :- Cancer is a disease that occurs when cells divide uncontrollably and spread into nea...
Q: Explain how human population, affluence, and technology affect the environment
A: Over-exploitation of natural resources, deforestation, pollution (soil, air, and water), habitat los...
Q: To ensure easier focusing, what should be done first before the HPO is swung into position?
A: High power objective lens is used to examine fine details of the given specimen. The total magnifica...
Q: How and why are avian and human muscles different?
A: Muscles are the the stretchy fiberes made up of soft tissue.
Q: How Would You Farm?
A: Farming is the practice of growing crops or raising cattle in a large area. It involves strong inter...
Q: The compound 2,4-dinitrophenol (DNP), which was used in diet pills in the 1930s but later shown to h...
A: Mitochondria is a site for aerobic phases of cellular respiration in cells.
Q: Which of the following is NOT an accessory organ of digestion? O gall bladder Ở salivary glands O ap...
A: Introduction :- The (accessory digestive organ) is a digestive organ that is not part of the dige...
Q: Which of the following G protein subunits activate K+ channels in response to the GPCR for acetylcho...
A: The G protein subunits that activates K+ channels in response to the GPCR for acetylcholine on heart...
Q: QUESTION 13 Normal (non-cancer) cells grewing in eulture DA Can be maietained infinitely (e are imme...
A: Plasma membrane is the outermost covering of all the living cells. Cancer is defined as uncontrolled...
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. ...
A: Translation is process in which proteins are synthesized.
Q: 7. Use the image to answer the following questions A student collects some of this bacteria to creat...
A: Answer 1:- Based on the microbiological examination of the slide shown in the question, the petri d...
Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...
A: The correct Answer is C
Q: What is the bearing of the following factors in establishing a taxonomic character: (a) numbers, (b)...
A: In biology, taxonomy is the scientific observation of naming, defining, and classifying corporations...
Q: Where is the sucrose produced by photosynthesis generated?
A: Photosynthesis includes light-dependent and light-independent phases.
Q: Photosynthesis is defined as the chemical process, wherein carbon dioxide in the presence of water a...
A: The plants have three basis needs to grow better. These are, 1) Sunlight 2) Water 3) CO2 Along with ...
Q: Figure It Out #5...Name that Complex Carb Fiber Sucrose Starch and Fiber Human Brain Human Liver Coo...
A: Galactose: Human Brain Fiber and Starch: Whole wheat bread Fiber and Sucrose: Starburst, Strawberry ...
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...
Q: Photosynthesis in green and purple bacteria does not produce O2. Why? How can these organisms still ...
A: Photosynthesis is the process that occurs in the presence of sunlight.
Q: Cross a heterozygous pea plant with a homozygous recessive pea plant. Draw a Punnett square to show ...
A:
Q: Which of the following characteristics of a water-insoluble substance is most important in governing...
A: The solubility in water of molecules is the tendency of molecules to gets dissolved in water. The ch...
Q: the following processes except a. alternative splicing to produce a secreted form of the T-...
A: Answer 1st answer - d) somatic recombination 2nd answer - d) CTLA4, SUPPRESSION
Q: malaria
A: Malaria is a life-threatening disease caused by parasites that are transmitted to people through the...
Q: which of the following is true of chemical signals? - they can only be perceived by the intended re...
A: Chemical signals utilise different neurotransmitters or chemicals( hormones) which act on the intend...
Q: Indicate your answer by writing Y if a characteristic and N if a non-characteristic. If the characte...
A: Eukaryotic organisms have well-developed nuclei surrounded by nuclear membrane while prokaryotes do ...
Q: Which of these is a tetrapod that is NOT an amniote? A. Ostrich B. Shark C. Rattlesnake D. Salamande...
A: Tetrapods are four-legged animals that include reptiles, mammals, and some extinct amphibians. These...
Q: Which of the following are characteristics of “small” monomeric Ras GTPases? A. Membrane boun...
A: Answer : The correct option is C because, RAS protein RAS proteins are small group of GTPase which ...
Q: Describe and explain the necessary changes that health systems worldwide must undergo to improve ada...
A: Introduction :- Healthcare system is a system consisting of institutions ( like hospitals, dispensar...
Q: 1. What are the pre-analytical phase in doing the Direct Fecal Smear? 2. Discuss the Cleaning and D...
A: Direct Fecal Smear is done for checking the presence of bacteria and parasites.
Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?
A: INTRODUCTION Evolution is a main thing happened by a natural process that mainly occur...
Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...
A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...
Q: You are a cat breeder and was asked to choose two parents (male and female) among a group of cats wi...
A: A genetic cross is the intentional mating of two people that results in the combination of genetic m...
Q: 2. Distinguish among inducible, repressible, and constitutive gene operons.
A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all regu...
Q: In the absence of Separase, how would this affect the chromosomes dynamic during mitosis?
A: Separase is an ubiquitous cysteine protease enzyme which remain inactivated (by forming complex with...
Q: Huntington disease is a neurodegenerative disease that appears in affected people late in life. It i...
A: An individual who carries a mutation for a dominant allele disorder usually is tend to be affected, ...
Q: explain how eugenics can be considered a pseudoscience by using at least two characteristics of pseu...
A: Solution : Eugenics is the scientifically erroneous and immoral theory of “racial improvement” and “...
Q: Auditory neural signals are sent when HAIR CELLS in our inner ears open ion channels along their pla...
A: The fluid that surrounds the hair cells, known as endolymph, is high in potassium. When the hair cel...
Q: Analyze the provided hypothetical neuronal set-up and its corresponding table which describes each n...
A: Nerve impulses are the key to the brain. They allow neuron to communicate with each other to deliver...
Is the human body intelligently designed?
Step by step
Solved in 2 steps