In guinea pigs, white coat (w) is recessive to black coat (W) and wavy hair (v) is recessive to straight hair (V). A breeder crosses a guinea pig that is homozygous for white coat and wavy hair with a guinea pig that is black with straight hair. The F, are then crossed with guinea pigs having white coats and wavy hair in a series of testcrosses. The following progeny are produced from these testcrosses: black, straight black, wavy 30 10 white, straight 12 white, wavy 31 Total 83

Q: Please label the tetrad type in the table as PD (parental ditype), NPD (non parental ditype) or T…

A: Tetrad analysis:  The tetrad analysis is usually done to determine the distance between the genes…

Q: Alleles of genes A and B were analyzed in Neurospora according to the cross shown below. Ordered…

A: The four haploid cells are produced by the process of meiosis and three kinds of patterns of growth…

Q: Drosophila (fruit-flies) mutants A and B have the same phenotype: the absence of red pigment in the…

A: The lack of red pigment in the eyes is the same feature shared by Drosophila (fruit-flies) mutants A…

Q: What are translocation and deletion events that mayoccur during chromosomal duplication or assembly?

A: Cellular biology explains the events starting from DNA synthesis, to replication, transcription, and…

Q: Why is the term “crossing-over” appropriate for the exchange of DNA segments between homologous…

A: Crossing over can be defined as the exchange of genetic material that occurs between the non-sister…

Q: What is mitotic recombination? A heterozygous individual (Bb)with brown eyes has one eye with a…

A: Mitosis is the process of somatic cell division. The union of the egg and sperm forms the zygote…

Q: Why are the nonrecombinant offspring more common than the recombinant offspring?

A: Reproduction is a natural process in which offspring’s are produced from the parents. Reproduction…

Q: With regard to the segregation of centromeres, why is adjacent-2segregation less frequent than…

A: A specialized DNA sequence of a chromosome which links the two sister chromatids is known as a…

Q: What phenomenon explains why the maximum percentage of recombinant offspring does not exceed 50%?

A: The pieces of DNA are broken then recombined and new combination of alleles are produced. This…

Q: Referring to Figure 17-19, draw a diagram showing the process whereby an inversion formed from…

A: An inversion is a type of chromosomal rearrangement in which a chromosomal segment is reversed end…

Q: In recombinant chromosomes, where is gene conversion likely totake place: near the breakpoint or far…

A: Gene conversion is a process in which a homologous sequence is replaced by the one DNA sequence in a…

Q: Why is random assortment of chromosomes necessary? What can we expect if this does not occur?

A: When reproductive cells mature, the Principle of Independent Assortment outlines how various genes…

Q: d.) If you recover 368 tetratypes, 1061 PD, 21 NPD tetrads are these genes linked or unlinked? If…

A: Pachytene is the third stage of prophase-1 meiosis (a five-stage process). It is preceded by the…

Q: What is the advantage of duplication and divergence of genes?

A: Chromosomal aberration is known as abnormality in the sequence or in the arrangement of the…

Q: chromosome of genotype   C D recombines with a homolog of genotype   c d during meiosis when Spo11…

A: * Given that chromosome of genotype  "CD"  recombines with a homologous of genotype  "cd" during…

Q: Is duplication a mutation?

A: Mutations are defined as the permanent change in the DNA’s base sequence. An agent that causes…

Q: Why is the upper limit of recombination 50% rather than 100%?

A: The genes are the primary unit of life. The nucleotide sequence of the genes are responsible for…

Q: Is homologous recombination an example of mutation? Explain.

A: Mutations are the changes in the DNA or chromosome. From changes in one base to the small fragment…

Q: Describe two forms of genetic recombination. What functions do they fulfill?

A: Introduction: The adjustment of DNA arrangements by the breakage and rejoining of chromosomes or…

Q: Explain why recombination events do not always result in crossing-over.

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: Why would an individual with a mutation that prevented the formation of recombination nodules be…

A: The synaptonemal complex between the homologs consists of large proteinaceous complexes, which are…

Q: What does recombination maps of a chromosome show?

A: In the field of genetics, understanding the organization of genetic material on a chromosome is…

Q: In Figure 5-17, how many crossovers are required to produce a completely prototrophic exconjugant?

A: The cell division causes the formation of identical daughter cells from the parent cell. The types…

Q: How to calculate recombination frequency between three genes? How does the map unit correlate with…

A: To find out the order of genes on a chromosome, a comparison of recombination frequencies may also…

Q: What do you suppose is the phenotype of this mutant strain?

A: the phenotype of this mutant strain is haploid, loss of mutations are Recessive

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: What does it mean for a mutation to be allelic?

A: Mutation is the alteration in the nucleotide sequence of the genome of an organism. It takes place…

Q: Researchers have discovered that some regions of chromosomes are more likely than others to cross…

A: Recombination hot spots are the regions of genome where it can undergoes recombination in higher…

Q: What characteristic specifically defines a High Frequency Recombination (HFr) cell line?

A: plasmid is an extrachromosomal DNA that can replicate independently.  F plasmid is called fertility…

Q: What gene is in the middle?

A: The genotypes found most frequently are the parental genotypes. Hence parents are: + + cn and b wx +…

Q: Explain why when a chiasma is formed, only 50% of the meiotic products will be of recombinant type.…

A: Chaismata  are the points on Homologus chromosomes where crossing over takes place between…

Q: determine the distance of the genes

A: 4. B.) Generally, the testcross with highest number of offspring represent the phenotype and…

Q: An individual has the following reciprocal translocation:What would be the outcome of alternate…

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: The following recombinant frequencies were found between genes A, B, C, D, and E. Determine the…

A: Mapping of linked genes on the chromosomes can be done by using the percentage or frequency of…

Q: What genetic event does the DSB homologous recombination model account for that the Holiday model…

A: In homologous recombination the nucleotide sequences are changed between the two identical or…

Q: If 2 genes on the same chromosome have a recombination frequency of .01, what is the genetic…

A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…

Q: As shown in Figure 13-14, what is the fundamental distinction between a pair-rule gene and a…

A: A pair-rule gene is a type of gene that plays a role in the creation of insect fragmented embryos.…

Q: A reciprocal translocation occurs in an individual between chromosomes 4 and 18, and this…

A: Introduction :- Translocation is defined as the process , When any part of one chromosome detached…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.