In a melting profile for DNA, the absorbance at 260 nm increases as result of the disruption of the DNA structure. What is the fundamental physical basis for the absorbance increase? a. the effective concentration of DNA changes b. the absorbance of DNA is highly sensitive to temperature c. native DNA absorbs light more strongly than denatured DNA because the bases are stacked d. denatured DNA absorbs light more strongly than native DNA because the bases have become unstacked

In a melting profile for DNA, the absorbance at 260 nm increases as result of the disruption of the DNA structure. What is the fundamental physical basis for the absorbance increase? a. the effective concentration of DNA changes b. the absorbance of DNA is highly sensitive to temperature c. native DNA absorbs light more strongly than denatured DNA because the bases are stacked d. denatured DNA absorbs light more strongly than native DNA because the bases have become unstacked

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

If you have G-C rich DNA versus A-T rich DNA, a. will the melting temperature be the same? Why b. Will the annealing temperature be the same? c. Which of the DNA above is more prone to errors?
How Can Fragments of DNA Be Separated From One Another? Agarose gel electrophoresis is a procedure used to separate DNA fragments based on their sizes. DNA is an acid and has many negative electrical charges due to the negatively charged phosphate-deoxyribose backbone. Scientists have used this fact to modify chromatography to separate pieces of DNA. A solution containing a mixture of DNA fragments of variable sizes is placed into a small well formed in an agarose gel (that has a texture similar to gelatin). An electric current causes the negatively-charged DNA molecules to move towards the positive electrode. Imagine the gel as a strainer with tiny pores that allow small particles to move through it very quickly. The larger the size of the particles, however, the slower they are strained through the gel. After a period of exposure to the electrical current, the DNA fragments will sort themselves out by size. Fragments that are the same size will tend to move together through the gel…
Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
Propose an experiment that would test the importance of ionic strength in the determination of DNA melting temperatures. Be specific.
Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’ a. Write the sequence for the complementary DNA strand. b. Write the sequence of the RNA complementary to the strand shown
A melting profile in figure below shows the increase in UV absorption versus temperature for two DNA molecules. What is the reason that two DNA molecules melt at different temperature? * 1.0 m Tm = 77°C Tm = 83°C 70 75 90 80 Temperature (°C) 85 95 OD P260
DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A = T.These bonds can be broken (denatured) in aqueous solutions by heating to yield two single strands of DNA(see Figure 1-13a). How would you expect the relativeamounts of GC versus AT base pairs in a DNA doublehelix to affect the amount of heat required to denatureit? How would you expect the length of a DNA doublehelix in base pairs to affect the amount of heat requiredto denature it?
Which of the following changes occur with a double-stranded DNA if it is heated to 95 C at neutral pH? OA Increase in the absorption of uitraviolet light at 260 nm OB. Unwinding of the helical DNA structure Oc Separation of the two DNA strands Do.Hydrolysis of the N-glycosidic bond belween the base and deoxyribose DE Breakage of the phosphodiester bonds belwean adjacent ucieotides Dr. Breakage of the hydrogen bonds between guanines and cytidines.
The two strands of a DNA double helix can be separated by heating. if you raised the temperature of a solution containing the following three DNA molecules, in what order do you suppose they would “melt”? explain your answer.A. 5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ B. 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’C. 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
Given the following DNA strand: TACAGAGATAACCGAATT A. Write the corresponding strand that would form the other half of the DNA molecule. B. Transcribe the original DNA strand (TACAGAGATAACCGAATT) and write the sequence of bases found in the resulting messenger RNA molecule. C. Translate your messenger RNA molecule and write the sequence of amino acids in the resulting protein (the genetic code is provided below).
When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and themolecule loses its helical form. We say the DNA hasbeen denatured. (Denaturation also occurs whenDNA is exposed to acid or alkaline solutions.)a. Regions of the DNA that contain many A–T basepairs are the first to become denatured as the temperature of a DNA solution is raised. Thinkingabout the chemical structure of the DNA molecule, why do you think the A–T-rich regionsdenature first?b. If the temperature is lowered, the original DNAstrands can reanneal, or renature. In addition to thefull double-stranded molecules, some molecules ofthe type shown here are seen when the moleculesare examined under the electron microscope. Howcan you explain these structures?