Identify the following structures, please label your answers with the corresponding number and be specific: 36. 37. 38. 36. Identify this structure 37. Identify this structure 38.
Q: Define the term “exchange surface” and list four common features of gas-exchange organs in animals.
A: Answer
Q: Why must the top agar be supplemented with MgSo4 A) it is required to induce the production of cro ...
A: The preparation of top agar is done by taking a low concentration of agar as compared to normal prep...
Q: MATCHING TYPE COLOUMN A COLOUMN B Simple, coiled tubular glands They mainly serve a thermoreg...
A: ANSWER: Matches of COLUMN A for Apocrine glands are: 3. Their yellow, viscous, oily secretion has an...
Q: phosphorylation
A: phosphorylation as a biochemical process in which a phosphate molecule is added to some organic comp...
Q: Describe briefly the perks, disadvantages and use of 16s rRNA genes in taxonomic level of classifica...
A: The gene sequence of 16s RNA comprises of hyper variable regions. These regions are known to provide...
Q: Among all these primer pairs from Primer-Blast, which is the best to use for a PCR reaction and why?
A: The hereditary currency of an organism is the gene. The gene is present in the DNA of an organism. ...
Q: Identify the genus of each of the sponge in the picture
A: Freshwater sponge, any of about 20 species of the genus Spongilla (class Demospongiae, siliceous s...
Q: 4 Distinguish between ionic and covalent bonding.
A: form We have to differentiate between ionic and covalent bond
Q: A. Directions: Examine the following statements, then decide which evidence of evolution does it sup...
A: Evolution is the process by which a group of organisms undergoes cumulative hereditary change over t...
Q: Biostatistics
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: Define malnutrition and identify a specific disease that can result from it. Perform library researc...
A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...
Q: Probe Loss of restriction site Insertion 4 Deletion> The smallest RFLP generated would be associated...
A: Introduction : RFLP ( restriction fragment length polymorphism ) is an first generation molecular m...
Q: Which best describes traditional classification? * a. It is based on shared characteristics....
A: * Traditional classification was proposed by Carl Linnaeus. * He categories them based on their str...
Q: Question: Genetically modified animal that might be approved for human consumption is a super “muscl...
A: Introduction CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats. This is ...
Q: escribe the main phases of imbitio
A:
Q: Dilute urine is produced when increased levels of are secreted. aldosterone antidiuretic hormone (AD...
A: * Dilute urine is produced when we take more water to make dilute blood plasma. *when we take less w...
Q: Not graded, What answer choice?
A: The genetic makeup of all cells is the same and contains same base pair sequences. The difference li...
Q: density
A: The size of Population is the number of individuals in a population. the average number of individ...
Q: Describe the theory of ‘fundamental causes of disease.” 2. Apply this theory to 1.) the epidemio...
A: In simple terms, a disease is a malfunction of an organism's structure or function that is not the r...
Q: Please help me with this questions. I provided an example on how it has to be done. I don’t complete...
A: A gene is a genetic unit that is arranged in thousands on the strands of DNA (deoxyribonucleic acid)...
Q: A. Endodermal cells constitute the innermost layer of root cortex and surround the vascular cylinder...
A: Option A is correct because:- The innermost layer of cortex in the root is called Endodermis, the En...
Q: Zoey is 25 years old. She does a two stage treadmill test to estimate her VO2max. For stage one, she...
A: The highest quantity of oxygen a person can use during intensive or maximal exertion is referred to ...
Q: Discuss three importnace of Archeae
A: Carl Woese gave 3 domain theory. The three domains given by him were - Archaea, Bacteria and Eukarya...
Q: the causal chain between genetics and social and red-headed children
A: Causal chain: its a sequence of events in chain in which any one of the events leads to the occurren...
Q: Consider the following, hypothetical data for the genotypic frequen- cies associated with the A, B, ...
A: ANSWER: Applying the Hardy-Weinberg law: Derivation of the Hardy-Weinberg Law- The law states that w...
Q: How does the skeletal help aid the body when it is sick?
A: Skeletal system comprises of bones and muscles which are arranged in a coordinated manner to help us...
Q: Enumerate disorders and diseases that result from the malfunction of the cell during cell cycle.
A: Answer
Q: REVIEW QUESTIONS: 1. Which type of evidence for evolution is most accurate in determining evolutiona...
A: 1. The evolutionary relationships between related species can be interpret by using a phylogenetic t...
Q: What is a thesis statement? In the context of biological research, a thesis statement is usually com...
A: Answer
Q: Which of the following could be used to turn on a regulon (composed of multiple genes and operons) i...
A: Regulon is a functional genetic unit composed of a noncontiguous group of genes that are regulated b...
Q: This is an example of a female wing. ARAN MORE VIDEOS gadwall shoveler pintail wigeon
A: * gadwall is common in dabbling duck. *Wingspan is 6 to 56 cm long * The wing shows light grey wit...
Q: Describe the biosynthesis Filovirus (Marburg virus genome. Discuss the transcription of the virus ge...
A: *Filovirus cause hemorrhage in humans. *Filovirus genome has negative sense RNA virus. *Negative sen...
Q: Some animals use diffusion instead of a circulatory system. Examples include: A. sponges and jelly...
A: The circulatory system is used by multicellular organisms to carry oxygen and nutrients throughout t...
Q: 'Define each type and give 1-2 vaccine per type A. Live Attenuated Vaccines 'B. Inactivated Vaccine ...
A: Given: Vaccines play an important role in keeping us healthy.They protect us from serious and someti...
Q: Aside from H&E, what other staining methods are applicable in Golgi apparatus, mitochondria, and nuc...
A: Stains are the dyes which are used to highlight structures in biological tissues.
Q: Refer to the tabulated details to accomplish the following. 1. State the genotype of # 8. 2. Identif...
A: According to our guideline we can answer only the first three subparts of the question. So, upload r...
Q: In tomato the mutant genes o (oblate=flattened fruit), p (peach=hairy fruit) and s (compound inflore...
A: Parents- Parent 1= + + s= 348 (the highest number) Parent 2= o p + =306 (complementary of parent 1) ...
Q: What is the significance of Pedigree charts?
A: Genetic analysis refers to the general procedure of exploring and investigating genetics-related sub...
Q: How does natural selection affects human?
A: Natural selection is the concept which was given by Darwin. According to this concept nature has the...
Q: Protein databases with mass spectrometry analysis are not useful in proteomics studies due to the co...
A: A mass spectrometer is a piece of experimental equipment that differentiates molecular ions in the g...
Q: 6. Describe the process of DNA sequence of interest detection, using these term appropriately, below...
A: *DNA sequencing is a technique used to find the exact sequence of bases like Adenine, Guanine Thymin...
Q: (True/False) There is no redundancy in enzymes that catalyze histone modifications, meaning that an ...
A: NOTE- Since you have posted multiple questions, we will be solving the first two questions as specif...
Q: Explain the importance of decomposition in an ecosystem. Cite an application of this process for hum...
A: Decomposition is the natural process by which large organic materials and molecules are broken down ...
Q: HOW DO AGE, LOCALITY, AND GENDER INFLUENCE HEMOGLOBIN CONCENTRATION OF AN INDIVIDUAL. AGE - LOCALIT...
A: All RBCs include haemoglobin, which is the major oxygen-carrying protein (red blood cells). It's an ...
Q: Which types of light cause damage to genetic material? (SELECT ALL THAT APPLY) ultraviolet visible l...
A: ANSWER;- a) Ultraviolet light causes damage to genetic material. Explain;- DNA can be harmed when it...
Q: Is the organism causing COVID-19 living or non-living? why? Describe the molecular and cellular mech...
A: The viruses, bacteria and parasites are responsible for causing different diseases which in human bo...
Q: Describe how you obtain energy from the food that you consume in an indirect way. Some species are a...
A: Along with exercise, hydration, and adequate sleep, the foods you consume play a critical part in ma...
Q: Question 1 A scientist constructs a recombinant bacterial plasmid that contains a gene conferring re...
A: Antibiotics are usually defined as the way that they are been medications that are used to treat bac...
Q: Explain in your own words the four levels of protein structure?
A: *proteins are made up of amino acids. *We have to know about the protein structures to get and know ...
Q: The light photomicrograph (see image below) shows a single type of bacterial cell treated with Giems...
A: Magnification = length of image ÷ actual length of organism
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 3:53 1 + t A 42.0 KB/S 7i ul l 62 chegg.com/homework-h 1 home / study / science / anatomy and physiology / anatomy and physiology questions and answers / asked with an image Your question has been posted. We'll notify you when a Chegg Expert has answered. Post another question. O Next time just snap a photo of your problem. No typing, no scanning, no explanation required. Get Chegg Study App Question: O Edit question Nerve Origin Movements muscles innervated Cutaneous or sensory innervation allary radial Muscilo-cutaneous ulnar median obturator Femoral nerve tibial Common fibular nerves Deep fibular nerve Superficial fibular nerve Sciatic nerve Gluteal nerves Pudendal nerves Mioinguinal nerve Lumbosacral nerves Expert Answero This question hasn't been answered COMPANY LEGAL & POLICIES CHEGO PRODUCTS AND SERVICES CHEGO NETWORK About Chegg Chegg For Good College Marketing Mobile Apps EasyBib Internships.com Advertising Choices Cheap Textbooks Cookie Notice Chegg Coupon Sell Textbooks…HEB Thursday - M M Inbox (158) HAC Home View Su X A web.kamihq.com/web/viewer.html?state=%7B'ids"%3A%5B 1dvxol57h6z004SawaUYeJo4xKCG613q5 %5D%2C'action"%3A'ope HE Course Modules: S A See the source ima. 6 New Tab A Classes HEB Course Modules: 7t. Winter Wonderland hebisd.edu bookmarks tudent Edu O O Camille Ervin - Monster Genetics_page_1.jpg Part 1 Procedure: 1. Flip a coin twice to determine the genotype for each trait and record it in the data table. Heads = allele 1, Tails = allele 2 (Example: if you fipped heads twice, your monster will hove two copies of ollele 1 for his genotype.) 2. Determine the phenotype resulting from the allele pair for each trait. 3. Repeat steps 1-2 for each trait and complete the female monster's Table 1. nary O Speech Table 1: Genotypes & Phenotypes for Female Monster Allele 1 Phenotype Trait Allele 2 Genotype Eye Two small eyes (E) One large eye (e) Eye Color (incomplete) Red (R) White (R') ment Skin Color Green (G) Blue (B) (codominant) Tail Shape 18…revised - see attached. Thanks
- Downloads G https://quizizz.com/joln?gc 組■回 O O 4x * -> A quizizz.com/join/game/U2FsdGVkX19TkkG3kLlisiMvowuyNnqAj4DOrKAİ%252BrxJxaTyev6Woj05VE1vYBQ81Qrk%252.. DeltaMath G Sign in - Google Ac. C Campus Portal Desmos | Graphing.. O Copy of Cherish sto. G Continue the Conve. 国 Readil HCS Bookmarks Y 10th 27500 +200pts What is the art of persuasion? rhetoric pathos ethos logos Music off O v1 3:17 Cop* :Grade Results K:Grade Results > flocabulary - Bing E Kinetic Ene https://scsk12.graderesults.com/gr/modules/activities/course.php?courselD=SUR6ITx9HA0Xi6q9by1VGg..&gradelD=D signmen... a Summary - Quizizz Classkick C Clever | Portal 1000+ Most Amazi... MasteryConnect :. SIS My Activities Tell me what you want to do Q Lesson Posttest Question 9 Points 3 Some organisms create antibiotics to prevent other species from growing. Which step of succession would include this behavior? exposure Competition Stabilization Migration Complete Later Complete Previous 00:00 / 00:00 Grade Results, Inc. © 2005-2021. All Rights Reserved,Pls someone explain this to me. I literally have no idea why the answer is 73. Any explanation for me to understand greatly appreciated and i will give thumbs .up.
- A piercemil.instructure.com Enter Accou Identify the following structures shown below, please label your answer with the corresponding number and be specific: 58. B. 58. Edit View Insert Format Tools Table MacBook Pro Q Search or enter website name %23 $ & 4 7 8. 9Outline the structure of the brain, spinal cord, peripheral nerves and theautonomic nervous system. please just 250 words thanksName this. Figure plz help
- ScX O 2020/ X Chapt O Pla + x ti Grades x - Micros x Attach x 2 Edpuz x (1) Dia x A quizizz.com/join/game/U2FsdGVkX19u5PV2q0828jgMm6BEgGF6fEPUbfvRFnusX%252BvbgoJX50wVADbL6X.. Johnson - Bo.. A Classes Course stream ti Planner - ProgressB. Holt McDougal Onli. G snake - Google Sear. O YouTube C 2KMTCentral | NBA A Actively Learn 1/7 Streak Whose research suggested that DNA was helical? Chargaff Watson Crick FranklinMail-Asia Parker - Outlook X peling 10.1 QuickLaunchSSO :: Single Si X - - ploymentid=4948542340617268223142630779&elSBN=9781305075030&id=1559525874&snapshotld=3065699a Assignments: ANATOMY & X O 2 Drag and Drop 1 3 Mind Tap 5 6 Extracellular f Potassium (K+ Cytoplasm Sodium (Na+) Sodium channel Potassium chann Clea:hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'