O a.Thylakoid membraneofNucleoidOc ChloroplastO d. MitochondriaO e. Respiratory membraneonHuman insulin is made up of A chain with 21 amino acid residues and B chain with 30 amino acid residues. How many peptide bonds are in eachchain?O a. 20 peptide bonds in A chain and 29 peptide bonds in B chainofOb. 21 peptide bonds in A chain and 30 peptide bonds in B chainc.19 peptide bonds in A chain and 28 peptide bonds in B chainO d. 23 peptide bonds in A chain and 32 peptide bonds in Bchain.Oe.22 peptide bonds in A chain and 31 peptide bondsin B chainhp Question30If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds betweenthe antiparallel strands?Not yetansweredO a. AAAAAATTTTTCCCCCGGGGGMarked out ofO b. GCGCGCGCCGCGCGCGE1.00Oc GGGGGCCCCCAATTCCCCCCP FlagquestionO d. ATATATATCGCGTTAAATTCTAO e TACTACACTGTGGTAATTAAAQuestion31Some bacteria can produce organic substances by using energy from suntight. Which of the following structures are most probably used bybacteria to perform this function?Not yetO a. Thylakoid membraneansweredMarked out ofO b. Nucleoid1.00O c.ChloroplastP FlagquestionO d. MitochondriaOe Respiratory membranehp

Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Human insulinis made up of A chain with 21 amino acid residues and B chain with 30 amino acid residues. How many peptide bonds are in each chain? O a. 20 peptide bonds in A chain and 29 peptide bonds in B chain O b. 21 peptide bonds in A chain and 30 peptide bonds in B chain O C. 19 peptide bonds in A chain and 28 peptide bonds in B chain O d. 23 peptide bonds in A chain and 32 peptide bonds in B.chain O e. 22 peptide bonds in A chain and 31 peptide bondsin B chain

Human insulinis made up of A chain with 21 amino acid residues and B chain with 30 amino acid residues. How many peptide bonds are in each chain? O a. 20 peptide bonds in A chain and 29 peptide bonds in B chain O b. 21 peptide bonds in A chain and 30 peptide bonds in B chain O C. 19 peptide bonds in A chain and 28 peptide bonds in B chain O d. 23 peptide bonds in A chain and 32 peptide bonds in B.chain O e. 22 peptide bonds in A chain and 31 peptide bondsin B chain

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Which component of an amino acid confers its uniqueness with respect to other amino acids? In other…

A: Introduction The chemical substances known as amino acids are what make up proteins. They are made…

Q: Why is it that not all the angles between C-N can freely rotate?

A: The peptide backbone is represented below. -N-Cα-C-N-Cα-C-N-Cα-C-N-Cα-C- As you can see, there are…

Q: How many atoms are held into a geometric plane by a peptide bond? 6 7 4 5…

A: A peptide bond is a covalent bond formed between the carboxyl group (-COOH) of one amino acid and…

Q: You are treating your bacteria with an antibiotic that binds to the D-ala-D-ala stucture of the…

A: Antibiotics kill or inhibit the growth of bacteria. They function by focusing on specific components…

Q: Which of the following is true concerning oligosaccharides? A Contain a maximum of 10…

A: Carbohydrates are made up of carbon, hydrogen, and oxygen in the ratio of 1:2:1. Carbohydrates…

Q: How are amino acid linked together in a forming protein

A: Amino acids are composed of carbon, hydrogen, oxygen, and nitrogen. They serve as building blocks of…

Q: At the center of all 20 standard amino acids is what is termed the a-carbon that is covalently…

A: Proteins are made up of amino acids and each amino acid has different functional group (R- group).…

Q: protein? 15. Which of the following describes the quaternary structure of a a. the structure…

A: Th correct answer is option (a). The quaternary structure of a protein is determined by the…

Q: Consider the amino acids lysine, valine, and aspartic acid in an enzyme. Which of these amino acids…

A: Lysine is a basic or positively charged side chain containing amino acid. Valine is a non-polar side…

Q: Using a diagram, show why a peptide bond is planar. Why are cis peptide bonds uncommon or rate in…

A: Proteins are macromolecules that are composed of monomeric amino acid units. Amino acids in turn are…

Q: Which of these are NOT components of an amino acid? hydrophilic tail b. side chain c. carboxyl…

A: Amino acids are the biomolecules which are building blocks and monomers of proteins. These amino…

Q: Which of the following is incorrect about the peptide Val-Leu-Ala-Ser-Gly? It has a net charge of…

A: H3+N-Val-Leu-Ala-Ser-Gly-COO- a) We have 1 positive charge at the N-terminal and one negative charge…

Q: What is the primary driver of protein folding on a macro level? a. Hydrogen bonding b. Van der…

A: The primary driver of protein folding on a macro level is:d. Entropic forceProtein folding is…

Q: The side chain of which residue can be hydrogen bond donor: a. Thr b. Ala c. Ile d. Pro e.…

A: There are twenty standard amino acids that makeup all the proteins present in our body. These twenty…

Q: What does a peptide bond join?

A: A peptide is a Greek word which means "digested". A peptide is an amino acid chain that is short in…

Q: The presence of a core alpha C atom distinguishes amino acids. o b. R group amino acids The…

A: Many organic molecules have a carbon-hydrogen bond (C–H bond). Carbon shares its outer valence…

Q: In the space below draw a dipeptide composed of lysine and glutamic acid bound together by peptide…

A: Amino acids are the building blocks of proteins. There are 20 amino acids that join together by…

Q: Which of the following is incorrect? Oa. None; all the other choices are correct O b. Disulfide…

A: Disulfide bonds are the bonds that are formed between two sulfhydryl groups. It is a covalent bond…

Q: Peptide bond formation occurs between which functional groups? SELECT ALL THAT APPLY A. Amino…

A: A protein is a polymeric macromolecule which is formed by linking together of many monomeric units…

Q: 4. Below is a polypeptide with an unknown number of amino acids. On the diagram below: a. Circle…

A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…

Q: How does the coplanar nature of the peptide bond impact the overall structure of D O a. a. It…

A: A peptide bond is an amide type of covalent bond linking two consecutive alpha-amino acids as shown…

Q: 12. Which of the following groups is NOT part of a nucleotide? A. A phosphate group B. An R group C.…

A: A nucleotide is the basic building block of nucleic acids. Here, are some multiple choice questions…

Q: 10.3. The simplest amino acid, region. contains a atom in its variable 10.4. How many different…

A: We are only answering the first three for you, if you want any other solution post it separately.…

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

O a.
Thylakoid membrane
of
Nucleoid
Oc Chloroplast
O d. Mitochondria
O e. Respiratory membrane
on
Human insulin is made up of A chain with 21 amino acid residues and B chain with 30 amino acid residues. How many peptide bonds are in each
chain?
O a. 20 peptide bonds in A chain and 29 peptide bonds in B chain
of
Ob. 21 peptide bonds in A chain and 30 peptide bonds in B chain
c.
19 peptide bonds in A chain and 28 peptide bonds in B chain
O d. 23 peptide bonds in A chain and 32 peptide bonds in Bchain.
Oe.
22 peptide bonds in A chain and 31 peptide bondsin B chain
hp

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

The largest number of amino acids found in proteins are ________ A. Polar B.hydrophobic C.hydrophilic meaning that they tend to be _______ water. A. Attracted to B. Repelled from
The side chain of which residue can be hydrogen bond donor: a. Thr b. Ala c. Ile d. Pro e. Phe
Which of the following amino acid side chains CANNOT form hydrogen bond? O a. O b. C. Gln Tyr Pro d. Asn O Oe. Thr
All 20 amino acids found in human proteins have a common structure that includes: A. An amino group (-NH2) B. A carboxyl group (-COOH) C. An R group D. A and B E. A, B, and C
Which of the following is true about the amino acid A? Click all that apply. Ois considered hydrophobic Charge of-1 at pH=7.0 contains a acidic side chain O side chain can form H-bonds Charge of O at pH= 7.0
1. Is there more than one way to fold a protein, given the conflicting demands of the different "R" groups and the protein existing in a watery environment? 2. Explain what an R group is. 3. Compare the backbone of a polypeptide with that of a nucleic acid. 4. Proteins perform critical functions in all of our cells. Without proteins, life wouldn’t exist. Think of some specific proteins and describe what function they perform. 5. Explain the difference between secondary and tertiary protein structures.
Arginine is considered a basic amino acid because its side chain ________ at physiological conditions (around pH 7). a. is protonated b. has a low pKa c. proton is titrated away d. is hydrophobic
Which of the following is incorrect about the peptide Arg-Asp-Cys-Tyr-Gln-Arg-Glu? It has six peptide bonds b. It has a net charge of zero at pH 7 It has six charged groups at pH 7 d. None; all the other choices are correct a. C.
Which functional groups of amino acids are involved in the formation of a peptide bond? O The carboxyl groups of both amino acids O The amino groups of both amino acids O The side chains of both amino acids A carboxyl group of one amino acid and the amino group of another A carboxyl group of one amino acid and the side chain of another