How many nucleotides would be required to synthesize a protein of 60 amino acids? 90 180 10 20 30
Q: List two types of DNA mutations and state which one is more likely to have a severe effect on the…
A: DNA mutations are a sudden change in the DNA sequence. Mutations can be caused by various factors,…
Q: What is the approximate molecular mass of a protein consisting of 150 amino acids?
A: Proteins are the unbranched polymer of standard amino acids. Amino acids are joined together by the…
Q: A monomeric protein contains 154 amino acids. How many codons code for these amino acids? How many…
A: Amino acids are joined by peptide bonds to form a polypeptide. A protien is a polymer of many…
Q: Draw a titration curve that represents the amino acid backbone?
A: The titration curve is considered as the graphical representation in which pH results in the change…
Q: What are proteins? How can the protein diversity of living beings be explained?
A: Biomolecules act as building blocks of life. Proteins are one such biomolecule which has different…
Q: What is the length of an α-helical section of a polypeptide chain of 20 residues? How do you…
A: Alpha helix has 3.6 amino acid per turn. Pitch of an alpha helix is 5.4.
Q: Draw a ribbon structure for the following polypeptide: (There is more than one right answer to this…
A: The polypeptide in question is likely to form intrastrand antiparallel beta-sheet. Beta-sheets are…
Q: What are the four steps for the production of a protein? What happens in each of these steps that…
A: Protein biosynthesis is a center natural interaction, happening inside cells, adjusting the…
Q: How many human proteins are in the range of 250,000 to 900,000 Daltons?
A: The human body is thought to have over a million different types of protein, and even a single-cell…
Q: Identify the number of amino acids per 360o turn of an alpha helix. Given this information, how many…
A: Proteins are composed of higher folding of linear chain amino acids adjoined via peptide linkages.…
Q: Draw at least 2 amino acids. Label the N-terminus and the C-terminus. Describe the property of the…
A: Amino acids are organic molecules composed of carbon, hydrogen, nitrogen, and oxygen. Amino acids…
Q: Define the term nucleotide?
A: The nucleotide is the basic building block of nucleic acids. Here we will know the definition and a…
Q: How many amino acids are in the following peptide? H₂N H3C ZI CH3 IZ O=C CH3 `N H HH OH | LOH
A: A polypeptide chain constitutes of amino acids are linked together via peptide bonds. The proteins…
Q: 10 b. How many different proteins composed of 100 amino acids could possibly exist?
A: The building blocks for the synthesis of proteins are amino acids. 20 different amino acids…
Q: Titin is a muscle protein named for its size. Its gene has the largest known coding sequence of…
A: Genes are made of nucleic acids called DNA. The variant forms of genes are called alleles. DNA is a…
Q: There are 22 amino acids used within the human body. How can these 22 molecules be used to make…
A: Amino acids are monomers of proteins.
Q: Which amino acids would you expect to find marked on the alpha helix? Alanine Isoleucine Leucine…
A: A prevalent motif in the secondary structure of proteins, the alpha helix (-helix) is a right-hand…
Q: Draw amino acids Methionine, Phenylalanine, Valine, and Phenylalanine
A: Introduction: Amino acids are organic compounds that contain the functional groups amino (–NH2) and…
Q: Create protein sequence with 10 amino acids
A: A protein is a polymer of amino acids. Two amino acids are joined together by forming a peptide…
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: Which of the following base change will result in the alteration of the net charge of the amino acid…
A: Proteins are composed of amino acids, which are joined together through peptide bonds. Proteins are…
Q: why are all 20 amino acids important for protein synthesis
A: Adult humans can't synthesize each of the twenty amino acids required for protein synthesis - those…
Q: If all cysteines in the correct section of the protein were able to form disulfide bonds, how many…
A: 2
Q: Your friend has discovered a protein that they suspect is glycosylated. They decide to perform a…
A: To solve this question one has to look at two parameters. One is beta-galactosidase cleave after…
Q: HOW MANY DIFFERENT PROTEINS CAN BE CONSTRUCTED THAT ARE EXACTLY FOUR AMINO ACIDS LONG? (HINT: THERE…
A: This problem can be used by multiplication rule of probablity. he multiplication rule of probability…
Q: Why do you suppose only l-amino acids and not a random mixture of the l- and d-forms of each amino…
A: L amino acids are compatible with life and support the life process in terms of providing proteins…
Q: How many nucleotides would it take to make a polypeptide chain that is 8 amino acids in length
A: It codes for a protein or a functional product rRNA (ribosomal RNA) or tRNA (transfer RNA). DNA is…
Q: A researcher isolates a new protein and finds that it contains 0.755% serine by weight upon amino…
A: A peptide is a short chain of amino acid residues linked together via a peptide bond. The peptide…
Q: pu've isolated a novel protein, but you believe what you actually have is mixture of the unmodified…
A: All the techniques described above in the options use one or more criteria to separate the protein…
Q: +H₂N-CH-COO™ I CH₂ 1 CH₂ 1 CH₂ I +H₂N-CH₂ A. O amino acid C O amino acid D O amino acid E amino acid…
A: The structural unit of proteins, that is made up of carbon, hydrogen oxygen and nitrogen are called…
How many
|
90 |
||
|
180 |
||
|
10 |
||
|
20 |
||
|
30 |
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Why is knowing the protein sequence important?Determine the number of proteins composed of 100 Amino acid... The solution read: total proteins composed of 100 nucleotides is equal to 20100 The solution should read total proteins composed of 100 Amino acids is equal to 20100 I did have someone answer me earlier about how to obtain the solution, however, I just believe there is a typo is the solution text. We are not looking for nucleotides, we are looking for Amino acids. So it should read total proteins composed of 100 amino acids is equal to 20100. If we were looking for nucleotides it would read 4100How many kilobases of the DNA strand below will code for the protein product?
- +H₂N-CH-COO™ T CH₂ I CH₂ 1 CH₂ I +H₂N-CH₂ A. O amino acid C amino acid D O amino acid E amino acid B +H₂N-CH-COO™ I CH₂ I CH₂ 1 O amino acid A C=0 B. If the pH decreases enough, this amino acid will become protonated and could contribute to the denaturation of the protein. +H₂N-CH-COO™ 1 CH₂ I OH C. +H₂N-CH-COO™ CH H₂C CH3 D.Draw at least 2 amino acids. Label the N-terminus and the C-terminus. Describe the property of the amino acids.Your friend has discovered a protein that they suspect is glycosylated. They decide to perform a series of tests to determine the nature of the oligosaccharide. Assuming/Knowing the following: Fucose molecular weight is approximately 164 Galactose molecular weight is approximately 180 GalNAc molecular weight is approximately 221 Mannose molecular weight is approximately 180 Sialic Acid molecular weight is approximately 309 Neuraminidase cleaves before a Sialic Acid (Sialic Acid and anything after leaves the protein) Beta-galactosidase cleaves after a Galactose (Galactose and anything before remains on the protein) Peanut Agglutinin binds to GalNAc Concanavalin A binds to Mannose Hemagglutinin binds to Sialic Acid Based on preliminary results, they suspect that the oligosaccharide is 7 glycosides long and weighs a total of 1414 g/mol They carried out the following experiments: they treated the protein with either a glycosidase or a lectin, and then pelleted the protein using…
- A researcher isolates a new protein and finds that it contains 0.755% serine by weight upon amino acid analysis. The molecular mass of serine is 105 g.mol-¹. What is the minimum molecular mass for the protein assuming only one Ser residue per protein molecule? mmin = The researcher estimates the molecular mass of the protein using gel electrophoresis. From this estimated molecular mass, the researcher concludes the protein contains 3 Ser residues. What is the estimated molecular mass of the protein as shown by gel electrophoresis? g.mol-¹ mest = g.mol-1A monomeric protein contains 154 amino acids. How many codons code for these amino acids? How many nucleotides?How many different proteins composed of 100 amino acids could possibly exist?
- List two types of DNA mutations and state which one is more likely to have a severe effect on the resulting protein structure and function. Please explain in 5 sentences or less, thank you!Why do you suppose only l-amino acids and not a random mixture of the l- and d-forms of each amino acid are used to make proteins?You've isolated a novel protein, but you believe what you actually have is a mixture of the unmodified and phosphorylated protein. Which of these methods would be best for helping you to determine if you do indeed have a mixture of phosphorylated and non-phosphorylated protein, while also establishing other vital characteristics of this novel protein? O 2D-PAGE O SDS-PAGE O Isoelectric focusing O Native-PAGE