How do R groups constrain the potential conformations of a protein?
Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…
A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…
Q: is lapoamide involved in oxidation reduction..
A: INTRODUCTION : First of all there is no such proper biochemical name like Lapoamide(its incorrect)…
Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…
A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…
Q: Disruption of which process will have the greatest impact on the number of electron carriers used by…
A: Disruption of which process will have the greatest impact on the number of electron carriers used by…
Q: The following proteins were separated by SDS-PAGE in the presence of mercaptoethanol. Sketch the…
A: SDS-PAGE is an electrophoretic technique that separates proteins based on their size. This method…
Q: An enzyme catalyzes a reaction with a Km of 6.50 mM and a Vmax of 2.00 mMs. Calculate the reaction…
A: The reaction (V0) or rate of reaction can be found by using the Michaelis Menten equation. V= Vmax *…
Q: You've got a solution containing 60 μM VIP (very important protein). VIP binds to its ligand L with…
A: Ligand-protein interactions are best described by their Dissociation Constants (KD). Let us…
Q: 1. The peptide below was isolated from fermented milk and shown to have antioxidant properties…
A: Peptide is polymer of amino acids linked by peptide/amide (covalent) bond with release of a water…
Q: Select ALL of the following that are made during the Kreb's Cycle. ATP CO₂ NADH FADH2
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: Which of the following is correctly classified? O Arachidic (20:0) is a medium chain unsaturated…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: The mitochondrial matrix is home for the following: I. ribosomes II. circular DNA III. Kreb's…
A: Mitochondria is a membrane bound organelle which is also known as power house of the cell as it is…
Q: 3. Use the structure shown below to answer the questions that follow: a b C. bottom. CH₂OH OH ) Name…
A: Carbohydrates are the important bio molecules that provide energy for the living organisms.…
Q: 2. You made a pH=2.5 buffer solution by mixing NaOH and glycine to give a solution that is 0.20 M in…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Initiation of transcription in prokaryotic cells requires not only RNA polymerase, but also an…
A: The sites of transcription on the DNA has three main regions viz., promoter region (upstream of the…
Q: Which metabolic event is not in the mitochondria? Oxidation of fatty acids ETC…
A: Glycolysis is a the pathway in which glucose is broken down into two three-carbon compounds and…
Q: Starch 1/2 English Muffin Fruit1 medium orange Milk 1 cup low-fat milk - Starch 1/2 c. Corn Protein-…
A: INTRODUCTION : Carbohydrates - Carbohydrates, or carbs(short name), are sugar molecules. Along with…
Q: 1. Why do proteins become polycations at extremely low pH and become polyanions at very high pH? 2.…
A: Proteins are biological macromolecules formed by monomers of amino acids. The amino acids have side…
Q: Inhibitors for this reverse transcriptase fall in two classes: nucleoside analog inhibitors (NRTIs)…
A: Reverse transcriptase is an enzyme that synthesizes DNA from RNA. Reverse transcriptase catalyzes…
Q: AMP is an activator of fructose 1,6-bisphosphatase (FBPase-1) True False
A: Glycolysis is the process by which one molecule of 6 carbon glucose is broken down into 2 molecules…
Q: At a substrate concentration that is much greater than the Km for the reaction, which statement is…
A: An increase in the substrate concentration increases the reaction velocity. The reaction reaches…
Q: Beer's Law to determine Protein Concentration You have purified a recombinant form of the p53…
A: The determination of protein concentration is necessary for diverse biochemical experiments. The…
Q: You measure Protein A and Protein B to have a Kd of 10-8 M. At what concentration of Protein B will…
A: Here we have 2 proteins, 'A' and 'B' . The reversible equilibrium between these 2 proteins is shown…
Q: Which technique would best seperate a protein that binds stongly to its substrate?
A: Chromatography is a technique that is used for separation of biological macromolecules form a…
Q: What is the total yield of NADH, FADH2, and acetyl-CoA from the complete oxidation of myristate?…
A: Myristic acid is a fatty acid with 14 carbon atoms. Beta-oxidation is the oxidation of fatty acid on…
Q: Please help me with finding the hypotheses that are being testing in each of the three enzyme…
A: Starch is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: The following peptides were separated using ion-exchange chromatography based on the use of an anion…
A: Ion exchange chromatography separates fractions based on net charge. There are two types of ion…
Q: Exergonic and endergonic biochemical reactions; the role of ATP and other macroergic substances in…
A: INTRODUCTION : ATP - Adenosine triphosphate, it is the main energy currency or units, which is…
Q: Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need…
A: DNA consists of two strands of polynucleotide that are linked to each other via hydrogen bonding…
Q: Ecol sticky end Putl SAATTCCTGCAGAAGCTT CITAA Synthetic polyliner Hindi N&CL Plasmid cloning vector…
A: The Enzyme Commission Number (EC Number) is a numerical classification for enzymes which is based on…
Q: Please help with 2a) 2a) There are two different DNA polymerase enzymes, DNA Polymerase I and DNA…
A: Replication is the process of duplication of two strands of a double stranded DNA. In bacteria, the…
Q: The drug troglitazone was used to treat diabetes but was withdrawn from the market when patients who…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Give the corresponding class, subclass, sub-subclass, specific enzyme of the following E.C. codes.…
A: Enzymes are proteins which serve as catalyst for a biochemical reactions. It doesn’t get involved in…
Q: Which one of the following statements about PEP (phosphoenolpyruvate) synthesis is correct? Pyruvate…
A: PEP, also known as 2-phosphoenolpyruvate, is a crucial biochemical intermediary. It participates in…
Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…
A: Note: As per the honor code we are allowed to answer the first two questions. Kindly resubmit the…
Q: For an enzyme-catalyzed reaction, the velocity was determined at two different concentrations of the…
A: The velocity of an enzyme catalyzed reaction is given by: V=Vmax×SKM+SWhere,V=velocity of the…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: What is the physical or structural difference between heterochromatin (also called "heterochromatic…
A: The term "chromatin" describes the DNA and protein combination that makes up the chromosomes present…
Q: F.28. How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change
A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…
Q: Although initiation requires the sigma factor or sigma subunit be associated with the core RNA…
A: Transcription is a process by which RNA is synthesized using DNA as template. Transcription occurs…
Q: Explain the principle involved for Tollen’s test.
A: Tollen's test is used to differentiate between the two carbohydrates with an aldehyde group or…
Q: The beta-pleated sheets are stabilized by hydrogen bonds among adjacent regions of the peptide…
A: Introduction Protein is the most abundant macromolecule in our body. proteins are made up of carbon,…
Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…
A: Reductant is a substance that donates electrons to another substance and reduce it. In an…
Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…
A: Phosphofructokinase-1 (PFK-1) is a rate limiting enzyme of the glycolytic pathway. PFK-1 catalyzes…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: Explain how RNA Pol II switches from strand initiation to strand elongation
A: RNA Polymerase II is a mulit-iprotein enzyme that transcribes DNA to messenger RNAs. RNA Pol II…
Q: Can someone give me an understanding of Products and Reactants? The first image is from the the…
A: Chemical reactions are processes that convert reactants into products. Some of the chemical…
Q: Hydrates Experiment: Cupric sulfate crystals were examined. Do you see any water in the crystals?
A: INTRODUCTION : Hydrates experiment - Most of the solid chemical compounds will contain some water if…
Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…
A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…
Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…
A: The prokaryotic cell is simple, not complex as the eukaryotic cell. In eukaryotic cells, the site of…
Q: dideoxy sequencing
A: Identifying the precise order of nucleotides, or bases, in a DNA molecule is done using a standard…
Step by step
Solved in 2 steps
- What Noncovalent Interactions Stabilize the HigherLevels of Protein Structure?Why is the 3-Dimensional structure important for protein function? What factors or agents can denature protein structure? Give examples (more than one factor) Why denaturation affect the function of proteins? Explain the structure - function relationship.What Noncovalent Interactions Stabilize Protein Structure?
- In regards to the protein structure, explain what is meant by “tertiary structure.” Whatare the main forces that stabilize tertiary structures in proteins? Provide examples.What common feature of α helices and β sheets makes them universal building blocks for proteins?is Tertiary protein structure come from secondary structure？How are they related？（do we need to build up a secondary structure before make it become tertiary？）