How can scientist sort chromosomes like that in a karyotype?

Q: how are all 46 human chromosomes able to fit into each of the microscopic cells in our bodies?

A: Chromosomes are the thread-like structures present inside a cell nucleus. Chromosomes are…

Q: How many genes are there present on chromosome 13 ?

A: Chromosomes are the carrier of genetic material deoxyribonucleic acid (DNA). They are coiled in…

Q: What do you mean by homologous recombination?

A: Genomes are dynamic entities that change as a result of mutations and recombinations. Recombination…

Q: How is the chromosome region where the centromere is located called? How are chromosomes classified…

A: Cell biology is considered as the study of cells, their structure, and their functions. The cells…

Q: How many genes are there present on chromosome 20 ?

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: How do we know that chromosomes exist in homologous pairs?

A: The eukaryotic cells contain different organelles like lysosomes, mitochondria, Golgi apparatus,…

Q: What is the importance of Chromosome Remodeling for the biological processes?

A: In the cell nucleus, the DNA chain is wrapped around a histone protein.  This complex of DNA chain…

Q: In which chromosome can you find FOG2?

A: Chromosome is a long DNA molecule which is found in nucleus of all cell.

Q: What is pairing of homologous chromosomes known as? Where that pairing takes place?

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: In what type of chromosome is the centromere is very close to one end?

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: Which classification is based on chromosome number?

A: Chromosomes are long thread like structures present in the nucleus of all the cells. The DNA…

Q: How does Allels relate to chromosome copy number (ploidy)?

A: Alleles are different forms of a gene that may occur alternatively at a given locus on a chromosome.…

Q: How do we know whether two chromosomes are homologous?

A: Homologous chromosomes are made up of chromosome pairs having  Similar length, Similar centromere…

Q: Why is karyotype done at metaphase?

A: Meta means middle, phase means stage. Metaphase is the middle stage of cell division. Karyotype is…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: What are the number of chromosomes in lung fish?

A: A chromosome is a compact structure of a DNA molecule wrapped around some proteins. It is generally…

Q: How many genes are there present on chromosome 10 ?

A: Introduction: Chromosomes are thread-like structures present inside the nucleus of plant and animal…

Q: explain the special mechanism used to replicate chromosome ends?

A: Chromosomes are DNA molecules that contain the genetic material of a living organism. The DNA…

Q: THE GENES A, B AND C ARE LINKED ON CHROMOSOME 2 OF S. CEREVISIAE. IN A SERIES OF TWO-POINT MAPPING…

A: In genetics, linkage refers to the tendency of genes on the same chromosome that are adjacent to…

Q: What are the number of chromosomes in mustard weed?

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: How many genes are there present on chromosome 21 ?

A: Chromosomes are thread-like structures that are located in the nucleus. It is composed of protein…

Q: How are reads, contigs, and scaffolds used to build a complete chromosome?

A:

Q: How many genes are there on chromosome 5?

A: Chromosomes are thread-like structure, which are composed of deoxyribonucleic acid (DNA) and…

Q: What is the approximate size of chromosome 7 inMb?

A: Chromosomes are thread-like structures that are located in the nucleus. It is composed of protein…

Q: How many genes are there present on chromosome 14 ?

A: Chromosomes are the small structures like a thread situated within the nucleus ofvarious  plant and…

Q: How do you determine the order of genes on a chromosome?

A: Genes are the structural and functional units of heredity that carry coded genetic information in…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.