How are these the same and different.

Q: What are these?

A: Answer: These are the giant multipolar neurons.  The commonest types of nerve cells are the…

Q: How Do Genetic Maps Correlate with Physical Reality?

A: Genetic map and physical maps are the terms related to genes present n chromosomes. A gene is a…

Q: Huntington’s Disease is a dominant lethal disease that manifests later in life after many people…

A: When individuals are able to gain an understanding of their genetic status, they are able to utilize…

Q: o certain drugs something that is genetically inherited? Explain

A: Addictions are a various set of common, complicated diseases that are to some extent tied along by…

Q: What is humification?

A: Decomposition is a biological process which involves the breakdown of complex organic matter into…

Q: How is DNA useful in studying psychology?

A: DNA stands for deoxyribonucleic acid, which is a molecule that carries the genetic instructions for…

Q: What does DNA include?

A: In eukaryotes, DNA is found inside the nucleus of the cell. Since the cell is exceptionally little,…

Q: How Are Human Genetic Disorders Inherited?

A: Genetic disorders are caused due to one or many abnormalities in the genome, this is mainly caused…

Q: How do steroids affect DNA?

A: Steroids are biologically active organic compounds or hormones that are naturally produced in the…

Q: What does it mean when systems are linked, and how closely do they resemble one another?

A: Linked genes sit close together on a chromosome, making them likely to be inherited together (left).…

Q: called

A: Introduction :- DNA is the heriditary material in humans and almost all other organisms. Nearly…

Q: The Effects of a Mutation are  Difficult to Predict Why?

A: A mutation is a change that occurs in the deoxyribonucleic acid (DNA)when it is damaged or changed…

Q: What factors affect DNA?

A: DNA is the genetic material found in humans and most organisms. It is responsible for the various…

Q: What causes your DNA to change?

A: the DNA is a highly protected molecule that is not allowed to change because it may cause…

Q: How many chromosomes are in a person?

A: Answer:  CHROMOSOME = These are the long molecules of DNA having genetic material present in all…

Q: Why Many Inherited Diseases Result from Multiple Genetic Defects?

A: Genetic disorders : When health problems caused by abnormalities in genome. Abnormalities occur due…

Q: How do we determine “best fit”?

A: Line of best fit alludes to a line through a dissipate plot of information focuses that best…

Q: What life experiences can someone havethat might coil or uncoil your DNA?

A: Epigenetics is an study of effects that environment and behavior have on genes.

Q: How are comunities distinguished?

A: A place where biotic as well as abiotic factors live together in harmony and interact with each…

Q: What do you mean by biparental?

A: Parental care is an evolutionary and behavioral strategy followed by the parents in order to…

Q: why dna is not destiny?

A: DNA is a double helix formed by base pairs attached to a sugar-phosphate backbone. It is hereditary…

Q: Lab Data G1 G2 G3 G4 G5 Released Тypіca 250 166 259 372 521 851 Carbonaria 750 308 254 234 210 199…

A: Gentotype and phenotype of an organism are related to the genetic material of an organism. The…

Q: How does a graph help us? What are they good for?

A: A graph is a diagram which represents the relationship between two data's or variables, each of the…

Q: What do you mean by genetic heterogeneity?

A: Genetics is the branch of biology that deals with the study of genome of an organism and its gene…

Q: what are the cons of phenotyping

A: The phenotype of the organism are collected by the process of DNA phenotyping which is obtained…

Q: How can differences in DNA from individuals be seen?

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Q: What is age and generation means?

A: A person is born with various characteristics in the world. Each individual has different aspects…

Q: How One Gene May Contribute to Several Characteristics?

A: Chromosomes are the carrier of genetic material deoxyribonucleic acid (DNA). They are coiled in…

Q: Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: How does knowledge of genetics helps to improve our lives?

A:

Q: Why is it really uncommon to have brown eyes with red hair?

A: It is really uncommon to have brown eyes with red hair.Brown eye colour is one of the most common…

Q: Every single cell in your body contains the same genetic information. Determining right and wrong

A: Every cell contributes to the organism's overall functioning. Cells are designed to execute certain…

Q: Do Changes in DNA cause Increased Cancer Risk ?

A: The growth of new cells and also the breaking down of the old cells generally occur by a systemic…

Q: What happens if you are missing chromosomes?

A: Chromosome is the DNA molecule with a part or all of the genetic material of an organism. Eukaryotic…

Q: mutations

A: Introduction:- Mutations  always change the DNA sequence ,they do not always cause a change in the…