D. OrganelleA. Two identicalthat buildscopies of DNAmicrotubule"highways" toguide DNAB. "staple" thatholds DNAcopies togetherC. DNA that is same length and hassame instructions; one from motherand one from fatherMatch the labeled structures to their proper term. guide DNAB. "staple" thatholds DNAcopies togetherC. DNA that is same length and hassame instructions; one from motherand one from fatherMatch the labeled structures to their proper term.|Structure AA. centromereStructure BB. homologous chromosomesStructure CC.centriolesStructure DD. sister chromatids

Cell division is a process of a parent cell replicating it chromosomal content and dividing itself…

guide DNA B. "staple" that holds DNA copies together C. DNA that is same length and has same instructions; one from mother and one from father Match the labeled structures to their proper term. C Structure A A centromere EStructure B B. homologous chromosomes Structure C C. centrioles Structure D D. sister chromatids

guide DNA B. "staple" that holds DNA copies together C. DNA that is same length and has same instructions; one from mother and one from father Match the labeled structures to their proper term. C Structure A A centromere EStructure B B. homologous chromosomes Structure C C. centrioles Structure D D. sister chromatids

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

A seiee hserved under a microscope, researchers observe that the DNA is able to be SE be replicated. Based on this observation, which protein involved in DNA replication is most likely mutated? To answer the question please: I) draw a scheme of DNA replication; 2) name the proteins that are required for DNA replication; 3) propose the consequences of the process.
. For each of the terms in the left column, choose thebest matching phrase in the rigf. satellite DNA 6. small basic proteins that bind toDNA and form the core of thenucleosomeg. chromatin 7. complex of DNA and proteinswhere spindle fibers attach to achromosomeh. cohesin 8. beadlike structure consisting ofDNA wound around histoneproteinsi. histones 9. protein complex that protectstelomeres from degradation andend-to-end fusionsj. shelterin 10. regions of a chromosome thatare distinguished by stainingdifferencesht column.a. telomere 1. protein complex that keepssister chromatids togetheruntil anaphaseb. G bands 2. origin of replication in yeastc. kinetochore 3. repetitive DNA found near thecentromere in higher eukaryotesd. nucleosome 4. specialized structure at the endof a linear chromosomee. ARS 5. complexes of DNA, protein, andRNA in the eukaryotic nucleus
Natte को irvicle ie wnd te the following DNA Olympics eralls a od come odents, at wy h wy ed ip the ar (warm up) y and anawers e Period a Name Caitlin Myers be writtenin usion sentena DIRECTIONS: Complete each of the following "events" in their proper order. In the first event, you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN'. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). our. thin 1. ATGCATGCGCGACTGG G G TC GGAGTGG 5TACaTACacaCTQACC CCAQCETCACC 31 MRAA -7 AUG CA aca ca4 Eug pca atq yeg sletion Yeu. eiy Ser. HiS. Protein AGI TTC 2. ATGGTACAGAA A A -ACCAT AAGITIIS MRNA- 3. ATGTGTCCAGGTACGTCGTAAGAGATC rotcin is actually a very long molecule composed of many hundreds or thousa Idod on itself many times to create a…
ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
AUG Met ACG ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: mutated MRNA: mutated protein: second letter G UCU UUU Phe UAU Tyr UGU UGC Cys UAA stop UGA stop| A UAG stop UGG Trp UUC UCC UAC Ser Leu UCA UUG UUA UCG G CUU CCU CAU CGU His CAC CAA CUC C CGC Leu CUA Pro Arg A ССА CGA Gln CAG CUG CCG CGG AUU ACU AAU AUC lle A AUA AAC Asn AAA AGC AGA AGU Ser ACC Thr АСА AAG LyS GAU ASP AUG Met ACG AGG Arg G GUU GCU GGU) GUC GCC GAC GGC Val GUA GCA Ala GAA Gly GGA A Glu GUG GCG GAG GGG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letter
a. As a result of the structure of DNA and RNA, replication, transcription and translation are possible. What can nucleic acids do, as a result of their structure, that enables these processes to occur? The figure below shows a simplified schematic representation of a segment of DNA. The DNA is labelled with the numbers 1 – 14 for easy reference. -35 sequence Pribnow box 5' UTR 3' UTR DNA TTGACA TATAAT -35 -10 Gene a Gene B Gene y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 UTR = untranslated region b. At which position on the DNA (number 1 - 14) will transcription be initiated? c. At which position on the DNA (number 1 - 14) will the first signal for translation be found? d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to indicate the region. e. Between which two regions on the DNA will the first Shine-Dalgarno / Ribosome Binding Sequence be found? Use the numbers to indicate the region.
BONUS: Why can't RNA viruses use cellular RNA Polymerase to copy their genetic information? Because cellular RNA Polymerases are O RNA Dependent RNA Polymerase O RNA Dependent DNA Polymerase O DNA Dependent RNA Polymerase O DNA Dependent DNA Polymerase prt s home
Stiller Paragraf how/or which the DNA repair mechanism fixes each mutation? (Ctri)
ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: DNA daughter strand: 5-AGA-ACT-AAA-CТА-ТСG-СTT-CGT-3' hnRNA: MRNA: original protein: mutated mRNA: mutated protein: second letter A G UUUPhe UCU) UCC UAU UGU Cys UUC U UUA UAC Tyr UGC Ser UAA stop UGA stop| A UAG stop UGG Trp UCA Leu UUG UCG G CUU CCU CAU CGU His CAC САА CUC CC CGC Leu Pro Arg A CUA ССА CG CGA Gln CAG SO AAU CUG CGG AUU ACU AGU AGC Ser A Asn AUC lle A AUA ACC AAC Thr AAA AAG Lys GAU АСА AUG Met ACG AGG Arg GUU GCU GGU U Asp GUC GGC GCC GCA GCG GAC Val GUA Ala Gly A GAG Glu GGG GAA GGA GUG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letter
Describe the double-stranded structure of DNA, and explainhow the AT/GC rule underlies the ability of DNA to be replicatedsemiconservatively
Describe the genetic roles of DNA helicase and DNA polymerase. Contrast the function of DNA polymerase with thatof RNA polymerase.